Team:SSTi-SZGD/Experiments
SSTi-SZGD
Synthetic organophosphates (OPS) are a group of highly toxic chemicals widely used to control various agriculture pests. Accounting for 38％ of total pesticides used globally. OP pesticides are acetylcholinesterase (ACheE) inhibitors , and various clinical effects can occur from OP poisoning in humans. The growing public concern about their safety and the widespread use of OPs in modern agriculture has stimulated the development of effective and safe remediation strategies for detoxification of Ops.
Organophosphorus hydrolase (OPH), encoded by the opd gene of Pseudomonas diminuta MG and Flavobacterium sp. Strain ATCC27551, is a homodimeric phosphotriesterase that can hydrolyze a wide range of OPs (4, 5). Hydrolysis of OPs by OPH reduces their toxicity by several orders of magnitude (3). Practical applications of large-scale enzymatic degradation have always been limited by the cost of purification and stability of OPH. Although the use of whole cell as biocatalysts is an alternative strategy for treatment of OPs, the inaccessibility of the pesticides across the cell membrane reduces the overall catalytic efficiency (2, 6). This barrier of substrate transport can be overcome by displaying OPH on the cell surface. However, surface expression of OPH resulted in instability of the cell membrane and growth inhibition of the cells, arising from increased metabolic burden placed on the cell (2, 6).
Recently, an OP degradation gene (mpd) encoding methyl parathion hydrolase (MPH) was isolated from a methyl parathiondegrading bacterium Plesiomonas sp. strain M6, but it showed only 12% identity to opd gene at the amino acid level (17), suggesting significant novelty of the gene-enzyme system. More recently, we cloned the mpd gene (GenBank accession no. DQ677027) from a chlorpyrifos-degrading bacterium Stenotrophomonas sp. Strain YC-1 (18). In the present study, to enable secretion of MPH to the periplasm of E. coli, we used the twin-arginine signal peptide of trimethylamine N-oxide reductase (TorA) from E. coli (19). We apply light control system to express a gene that encodes hydrolase to degrade pesticides residues.
MATERIALS AND METHODS
Bacterial strains and Plasmid Construction
The DH5 alpha E.coli strain was used to amplify plasmid and a negative expression control. The Luria Bertani broth medium used in this study was composed of 1.0 % (w/v) tryptone , 0.5% (w/v) yeast extract and 0.5% (w/v) NaCl in distilled water . the ph was adjusted to 7.0 with a NaOH solution-soid plates were obtained by adding 1.5% (w/v) agar . the antibiotic 1000ug/ml Penicillin and streptomycin (final concentration) was added during plate preparation after solution cooling or to the LB medium prior to culture.
The torA gene fragment encoding the signal peptide and the first four amino acid residues of the mature TorA was amplified by polymerase chain reaction (PCR) from plasmid pSCTorAGFP using primers P1 and P2. The PCR products were digested with EcoRI and BamHI, and then ligated into similarly digested pUC18 to generate pUT18. The mpd gene was amplified by PCR from plasmid pMDQ using primers P3 and P4. The PCR products were digested with BamHI and HindIII, and then ligated into similarly digested pUT18 to generate pUTM18. To construct a control plasmid expressing cytoplasmic MPH, the mpd gene was amplified by PCR from plasmid pMDQ usingprimers P5 and P4. The PCR products were digested with EcoRI and HindII I, and then ligated into similarly digested pUC18 to generate pUM18. All plasmid constructions were verified by DNA sequence analysis. Transformation of the plasmid into E. coli was carried out by using the below method.
Cell condition and Cell Fractionation
Sub-cultures were grown overnight to added suitable the concentration of antibiotics in 5ml LB and used to inoculate 30ml LB liquid to a starting OD600 of 0.5, cells were shaking culture at 37℃, when cultures reached a cell density of 1.0~2.0, used silver paper to make the culture be in dark ambient induce recombinant protein expression.
Cells were fractionated to yield cytoplasmic by the cell lysis solution ,and periplasmic samples by the Arginine buffer as follows, the E.coil strain cell medium by centrifugation 10000rpm, 5 min, and the 1 g cell added 10ml concentration of arginine buffer 0.4mol/L ,pH8.0, after extracting time 45 min on the ice by the centrifugation 10000rpm, the supernatant is periplasmic.
And we used “Soluble protein solution” to extract the cytoplasmic, used in this study was composed of 0.0625mol/L Tris- HCl, the ph was adjusted to 6.8 , 2% (w/v) SDS, 10%(w/v) glycerol and 5% 2-mercaptoethanol were obtained extract . Take the strain centrifugation 10000rpm,5min at 4℃, 15ml PB wash cell, centrifugation by the bacterium suspension, discard the supernatant, Repeat that steps twice. Added 200ul to soluble protein solution, to make the bacteria fully suspended and,10min boilingwater to make it inactive. Centrifugation 12000rpm,15min collect supernatant, keep at -20℃.
Analytical assays
Periplasmic protein were (OD600=1.0) in 100 mM phosphate buffer (pH 7.4). MPH activity assay mixtures (1 mL, 3% methanol) contained 50 μg/mL methyl parathion (added from a 10 mg/mL methanol stock solution), 870 μL of 100 mM phosphate buffer (pH 7.4), and 100 μL of cells. The enzyme activity was measured using a UV/VIS spectrophotometer (UV-1601PC; Shimadzu Corp., Kyoto, Japan) at 30 C by monitoring the increases of linear optical density over time at 405 nm as methyl parathion was hydrolyzed to p-nitrophenol (ε405=17,700 M-1 cm-1). Activities were expressed as units (1 μmol of p-nitrophenol formed per minute) per OD600 whole cells.
Project—Mhei-mcherry in E.Coli DH5α Strain
There is only one Earth for human beings living，we concerned about the environmental problems but can’t reduce its damage. Our project aim at pesticide residues，and degradation of pesticide residues in soil and plants which serves a positive role in Earth and maintaining balance.
Carbendazim，alias carbendazol、benzimidazole 44; belongs to the Carbamate Pesticide, is a highly activity, keenly priced, broad-spectrum fungicide widely used for the control of plant fungal diseases on arable crops、fruits、vegetables and ornamentals which results in potential environmental contamination. Annual output just after Organphosphorous pesticide and ranked the second place. This kind of pesticide has a control effect on a variety of crops caused by fungi (such as semi-bacterial bacteria, multi-seed bacteria) and can be used for foliar spraying, seed treatment and soil treatment. Also can prevent wheat disease, anti-rice disease, anti-fruit and vegetable poisoning, prevention and control of cotton diseases etc. On the contrary, there are many reports on its toxicity at both here and abroad，such as it has toxicity to Low aquatic organisms、low soil animals、 plants etc. It can inhibit the root development of alfalfa affect the number of nodulation and nitrogen fixation capacity too. Carbendazim also occurs in the mammal’s stomach nitrosation reaction, and formation of nitrite compounds, causing rodent testis and epididymal damage, may also damage the liver and endocrine system, cause animals have mutagenic and teratogenic effects. What ‘more，Carbendazim pesticides after rainwater scouring or dust landing will get into the soil, once entering into the soil mays effect microbial community to grow.
- Reference by Biodegradation of carbendazim by a novel actinobacterium Rhodococcus jialingiae djl-6-2
Materials and methodsConstruction of recombinant plasmid pLEVI(408)-mhei-mcherry（1） 6545bp
Cloning and expression of MheI
Mycobacterium sp.SD-4 is a Carbendazim-degrading bacterium，and its MheI hydrolases play a role，we synthesize MheI gene and subcloned into light-off plasmid. Use pMD 18-T vector transformed it into E.coli DH5α Strain which we have Optimization codon .Culture bacteria in 18 h LB medium (Fig 1).. Then，use TAKARA MiniBEST Plasmid Purification Kit Ver.4.0 to extraction plasmid (Fig 2).
-Reference by Identification of the key amino acid sites of the Carbendazim hydrolase（MheI）from a novel Carbendazim-degrading strain Mycobacteria sp.SD-4
Verification of recombinant gene
Design two primers one is ColonyF(GCGGCGTAGCTTTTATGCTG) the other is Mhei-colonyR(CACATAGGGGTTCAGCGAGG) Pick ten typical colony from the plate【Fig 3】and add in PCR Reaction system(Use TAKARA Taq). Agarose gel test the result.【Fig 4】.
Protein extraction
Pick typical colony in 5 mL LB liquid medium and incubated for 17 h to OD600 about 0.5 and remove 2 mL bacteria liquid in 30 mL LB liquid medium, incubated and pack paper all over for 17 h to OD600 was about 2. Extraction of cytoplasmic protein by ultrasonic crushing. Make SDS-PAGE【Fig 5】(12% Resolver and 6% Stacker)
-Reference by ISOLATION AND CHARACTERIZATION OF CARBENDAZIM-DEGRADING STRAINS,CLONING AND EXPRESSION OF THE MheI GENE
Determination of protein content
Coomassie brilliant blue determination of protein content，preparation of bovine serum albumin standard curve.
We calculated the total protein content of MheI was about 33.969 ug/ mL.
Enzyme activity assay
Enzymatic activity of MheI-6F was examined using MBC as the substrate. Samples were pretreated according to a protocol adapted from Xu et al. (2006) and improved for determining the catalytic activity of MheI-6F in our study. Five milliliters of hydrolyzing system that includes 0.2 mol/L disodium hydrogen phosphate—0.1 mol/L citric acid buffer solution (pH 7.0) and 40 μmol/L MBC was pipetted into three 10 mL flasks.MheI-6F was added to each flask at the final concentration of 0.10 μg/mL. The mixtures were then incubated at 37°C for 1 hr, and warmed in a hot-water bath for 5 min to terminate the reaction. Five milliliters of ethyl acetate was added to each flask to terminate enzyme activity after 1 hr incubation. After 2 min of extraction by ethyl acetate, the organic phase was collected and dried over anhydrous sodium sulfate. Hydrolysis of MBC by MheI-6F was measured by examining the absorbance of MBC at 287 nm by ultraviolet spectrophotometry (U-3310, Hitachi Limited, Japan)
-reference by Hydrolysis mechanism of Carbendazim hydrolase from the strain microbacterium sp.djl-6F
Results and Analysis
The Carbendazim hydrolase was a constitutive enzyme，mainly located in cell.The optimum Ph value and temperature for the Carbendazim hydrolyzing activity of this enzyme was 7.0 and 37℃.
Light off system
As we know in bacterial cells, a few light-regulated gene expression systems based on photoreceptors and two-component regulatory systems (TCSs) have been reported, which respond to blue, green or red light [1-5]. These systems have already been used for a number of synthetic biology studies. Particularly, sophisticated temporal control of gene expression with unparalleled accuracy and precision can be achieved using these systems [1, 3-5]. However, their widespread usage is limited by a few drawbacks:
1) limited portability due to multiple components,
2) dependence on extraneous light-sen-sitive cofactors and appropriate cofactor synthesis genes ,
3) low yield of recombinant proteins due to weak induction efficiencies (much less than T7 expression systems) ,
4) lethal effect when gene product is toxic and difficulties in studying low-abundance proteins due to high leakage under the non -inducing conditions .
An ideal light-switchable gene expression system should be simple and easy to manipulate, and has high induction efficiency, low leak-age, high sensitivity toward light, low toxicity, and low interference with endogenous proteins or genes.
Therefore this year we improve the system based upon ECU University. In order to create a light switchable system , we fused the blue light sensor VIVID (VVD), a small light-oxygen-voltage (LOV) domain-containing protein from Neurospora crassa, to the C-terminus of DNA-binding domain of LexA repressor of the Escherichia coli SOS regulon.
When it expose on blue light, a cysteine-flavin adduct is formed in the VVD domain,causing conformational changes of the domain and the subsequent dimerization of the fusion protein The activated protein dimer would then bind its cognate operator sequence and repress the promoter activity. [Figure A]
In contrast, when in dark, dimerization would not occur, therefore the promoter activity is not repressed and gene express proceeds.
LexA(1-87) gene fragment was amplified from the genome of JM109(DE3) cells, and was fused to VVD (37–186) with N56K C71V double mutations from pGAVPO7 to generate chimeric
Fusion gene LexA-VVD ,which was then fused to the constitutive promoter bbaJ23116 from iGEM,and rrnB transcription terminator from pBAD/His vector using overlapping PCR and inserted into BglII and EcoRI sites in pCDFDuet1 vector (Noagen company) whose promoter and MCS region have been removed, the resulted vector was named as pLEVI.
ColE promoter was synthesized by Shanghai Generay Biotech Co. Ltd., and fused to rrnB transcription terminator and mCherry gene from pU5-mCherry7 using overlapping PCR, cI gene fragment and R-O12 promoter were amplified from the genome of λ phage and fused to ColE promoter and mCherry gene to generate colE-cI-Pλ(R-O12)-mCherry DNA fragment, then was inserted into KpnI and Eco47III sites in pLEVI-mCherry to obtain pLEVIon-mCherry vector. mCherry gene was inserted into NcoI/EcoRI of pBAD/His, BamHI/XhoI of pET28a and pDusk or pDawn (Addgene: #43795 and 43796) to generate pBAD/His-mCherry, pET28a-mCherry and pDusk-mCherry, respectively.
Photoreceptor LEVI
LEVI is the only single-component light-switchable repressor to date, which shall reduce the possibility of interaction with the host chassis. LEVI can be used to control transcriptional activities of various promoters, in which LexA cognate operator sequence is incorporated , il-lustrating the adaptability of LEVI. Therefore, LEVI maybe used to control gene expression in other bacteria and even in eukaryotic cells
According to literature, It’s showed that the LightOff system can be applied successfully for large-scale pro-duction of recombinant proteins by high-density (OD600 ~20) fermentation using 5-L bioreactor (Figure 1G and Supplementary information, Figure S2F), which has not been demonstrated by any other prokaryotic light-switch-able gene expression system. Such ability of the LightOff system is not only convenient but also cost-saving com-pared with chemical inducers.
Large-scale production of recombinant protein using fermenter by LightOff system.
JM109(DE3, ΔsulA, ΔLexA) cells transformed with pLEVI-mCherry vector, 5% (v/v) of the seed culture was inoculated to 5-L fermenter. The cells were illuminated with blue light illumination or transferred to dark condition to induce mCherry expression when OD600 reached ~2.0. Fluorescence and OD600 were measured at indicated time points. Error bars, mean ± SD (n=3 samples) from the same experiment. a.u., arbitrary units.
mCherry expression regulated by the LightOff system in JM109 (DE3, ΔsulA, ΔLexA) cells and pDusk system in BL21 (DE3) cells was analyzed 18 h after cells were cultured with light illumination (non-induction) or in darkness (induction). mCherry expression regulated by pET system in BL21 (DE3) pLysS (pET system1) or BL21(DE3) (pET system2) cells and pBAD system in TOP10 cells was analyzed 18 h after cells were cultured without (non-induction) or with addition of chemical inducers (induction). Data shown were normalized to mCherry expression level in BL21(DE3) cells with the pET sys-tem in the presence of chemical inducer.
Transformation
•The lyophilized powder is centrifuged first. Open the lid by adding 40 μl of ultrapure water to dissolve, mix well and collect the liquid again by centrifugation.
Transformation
1.Take 2 ul of the plasmid into the 100 ul competent cells, put in the ice for 30 minutes.
2.Followed by a water bath at 42℃ for 45 seconds and then for 1 minute in ice.
3.The whole volume was transferred to 890 ul SOC medium and cultured at 37 ℃ for one hour.
4.Centrifuge 5000 rpm, 5 minutes，discard the supernatant.
5.The cells were disrupted with 100 ul of LB liquid, coated on LB-resistant plates containing 800 mg / mL streptomycin.
6. 37 ℃ first culture for an hour, and then upside down culture about 16 hours.
Colony PCR
•Primer
①VF1
AGTTGGAACCTCTTACGTGC
②supernova-colony-R
CGTACTGGATCAGGTGGCAG
③mhei-colony-R
CCATGTTATCCTCCTCGCCC
④SB-prep-3P-1
GCCGCTGCAGTCCGGCAAAAAA
⑤SB-prep-2Ea
ATGAATTCCAGAAATCATCCTTAGCG
1.Take 2 ul of the plasmid into the 100 ul competent cells, put in the ice for 30 minutes.
2.Followed by a water bath at 42℃ for 45 seconds and then for 1 minute in ice.
3.The whole volume was transferred to 890 ul SOC medium and cultured at 37 ℃ for one hour.
4.Centrifuge 5000 rpm, 5 minutes，discard the supernatant.
5.The cells were disrupted with 100 ul of LB liquid, coated on LB-resistant plates containing 800 mg / mL streptomycin.
6. 37 ℃ first culture for an hour, and then upside down culture about 16 hours.
•Perform PCR with Takara Taq enzyme （total 20 ul）
•Program
Bio-brick PCR
•Primer
①mheI-F
GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGCGAACTTTGTGCTG
②mheI-R
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTAACCCAGCGCCGCCAG
③LEV-F
GTTTCTTCGAATTCGCGGCCGCTTCTAG ATGAAAGCGTTAACGGCC
④LEV-R
GTTTCTTC CTGCAG CGGCCGC T ACTAGT A TCATTCCGTTTCGCACTGG
•Perform PCR with Takara Taq enzyme （total 20 ul）
•Program
Light induction & Extraction of periplasmic/cytoplasmic protein
Light induction
1.Sub-cultures were grown overnight to added suitable the concentration of antibiotics in 5ml LB and used to inoculate 30ml LB liquid to a starting OD600 of 0.5, cells were shaking culture at 37℃.
2.When cultures reached a cell density of 1.0~2.0, used silver paper to make the culture be in dark ambient induce recombinant protein expression.
Extraction of periplasmic protein
1.Cells were fractionated to yield cytoplasmic by the cell lysis solution ,and periplasmic samples by the Arginine buffer as follows, the E.coil strain cell medium by centrifugation 10000rpm, 5 min.
2.The 1 g cell added 10ml concentration of arginine buffer 0.4mol/L ,pH8.0.
3.After extracting time 45 min on the ice by the centrifugation 10000rpm, the supernatant is periplasmic .
Extraction of cytoplasmic proteins
1.We used “Soluble protein solution” to extract the cytoplasmic, used in this study was composed of 0.0625mol/L Tris- HCl, the ph was adjusted to 6.8 , 2% (w/v) SDS, 10%(w/v) glycerol and 5% 2-mercaptoethanol were obtained extract .
2.Take the strain centrifugation 10000rpm,5min at 4℃, 15ml PB wash cell, centrifugation by the bacterium suspension, discard the supernatant,
3.Repeat that steps twice.
4.Added 200ul to soluble protein solution, to make the bacteria fully suspended and,10min boilingwater to make it inactive.
5.Centrifugation 12000rpm,15min collect supernatant, keep at -20℃
Enzyme activity detection
1.OPH periplasm enzyme acitvity
•OPH activity assay mixtures (1 mL, 3% methanol) contained 5 μl paraoxon (added from a 10 mg/mL methanol stock solution), 870 μL of 50 mM Tris-HCl buffer (pH 7.4), and 100 μL of cells.
•The enzyme activity was measured using a UV/VIS spectrophotometer at 37℃ by monitoring the increases of linear optical density over time at 405 nm as parathion was hydrolyzed to p-nitrophenol (ε405=17,700 M-1 cm-1). Activities were expressed as units (1 μmol of p-nitrophenol formed per minute) per ml (total reaction volume).
Enzyme activity stability
1. OPH Stability Study of Resting Cultures
•Cells were grown in 30 mL of LB medium supplemented with dark condition to induce and
•100μg/m Lpenicillin-streptomycin for 20 h, washed twice with 50 mL of 150 mM NaCl solution,
•Resuspended in 5 mL of 100 mM phosphate buffer (pH 7.4), and incubated in a shaker at 30 ℃.
•Over a 2-week duration, 0.1 mL of sample was removed each day.
•Samples were centrifuged and resuspended in 0.1 mL of 100 mM phosphate buffer (pH 7.4).
HPLC
1.The collection and preparation of samples
Will be back to the sample all poured on the glass plate, paved into a thin layer, in the shade to make it slowly dry. The dried sample was crushed with a glass rod and passed through a 2 mm sieve to remove more than 2 mm of gravel and plant residue. The samples were repeated by four-fold shrinkage, and finally left enough to analyze the sample, and then further with a glass mortar to be ground, all through the 60 mesh metal screen. Sieve the sample, shake well, bottling analysis.
2.Sample preparation
10g of the soil sample was extracted with 15 mL of methanol: ddH₂O solution (4: 1, v / v) and the mixture was shaken at 200 rpm for 15 minutes. The sieve was then rotated and centrifuged at 6000 g for 5 minutes. The precipitate was treated three times in the same manner and all supernatants were added together. 20 mL of petroleum ether was added to the supernatant to remove lipophilic impurities and the mixture was shaken at 200 rpm for 20 minutes and then the petroleum ether phase , The remaining solution was dried over anhydrous sodium sulfate and evaporated at room temperature with a vacuum rotary evaporator. The residue was redissolved in 5 mL of methanol, mixed thoroughly in an ultrasonic bath for 5 minutes and analyzed by HPLC.
3.Analysis conditions
The mobile phase was methanol: ddH 2 O (4: 1, v / v) at a flow rate of 1.0 mL min -1. MBC, 2-AB and 2-HB were detected at 230 nm by UV-900 detector.
4.Standard working solution preparation
Accurately weighed carbendazim (2-AB / 2AB / p-nitrophenol) standard 0.001g, take 1ml of methanol dissolved 1mg / mL single standard stock solution, take the stock solution 100ul plus methanol 900ml diluted to 100ug / mL Standard working fluid.
5.Methyl parathion standard solution preparation work
(100 μg • mL -1) 0.5 mL to 10.0 mL volumetric flask, acetone constant volume (concentration of 5 μg • mL, dilution and preparation of 0.1,0.2,0.5,1.0,2.0 μg • ML -1 organic phosphorus standard series solution.
