Team:IISc-Bangalore/Assembly

  1. BioBrick Transformations
  2. Plasmid Isolation
  3. PCRs
  4. Restriction digests
  5. Ligations
  6. Screening

BioBrick Transformations

The five BioBricks we are using were transformed into E. coli strain DH5α — chosen for its recA and endA mutations that allow for high-yield minipreps.

BBa_K525998
BBa_K624004
BBa_K863200
BBa_K543020
BBa_K731721

Plasmid Isolation

Minipreps were performed from three colonies on each plate to confirm the presence of the plasmid. One colony from each positive transformants was used to make a glycerol stock.

INSERT GEL IMAGES

PCRs

Our assembly begins with our PCRs: using carefully-designed primers with 5'-overhangs, we add restriction sites, linkers and other features to our parts of interest. Since most of our PCRs have such overhangs, our annealing temperature changes after the first few cycles — our PCR cycle parameters account for this variation. In addition, we used NEB's Q5 MasterMix and NEB's Phusion polymerase, both high-fidelity DNA polymerases which have a higher annealing temperature than usual.

PCRs for the T7 expression backbone

PCR 1 — T7 Expression Backbone (Piece 1)
Template BBa_K525998 (T7 promoter+RBS)
Forward primer gactaccacggcatgatgaacctgaatcgc
Amplifies the CmR gene, includes NcoI site
Reverse primer gaattcAAGCTTtttctcctctttccctatagtgagtcg
Adds HindIII site downstream
Amplicon size 886 bp
PCR 2 — T7 Expression Backbone (Piece 2)
Template BBa_K731721 (T7 terminator)
Forward primer gtatcacgaggcagaatttcag
Keeps the NheI site
Reverse primer gagaatatgtttttcgtctcagcc
Splits the CmR gene, includes NcoI site
Amplicon size 1533 bp

PCRs for sfGFP-SpyCatcher

PCR 3 — sfGFP
Template BBa_K1321337 (sfGFP in Freiburg format)
Forward primer gaattcAAGCTTatgACCGGTcgtaaaggcgaagagctgttc
Adds BBa_K2319001 (HindIII+ATG+AgeI scar) upstream
Reverse primer gGAATTCggatccTGACCCTCCtttgtacagttcatccataccatg
Adds Gly-Gly-Ser and BamHI site downstream
Amplicon size 753 bp
PCR 4 — SpyCatcher
Template BBa_K1650037 (SpyCatcher)
Forward primer GAATTAggatccGGGAGTAGCtcttattatcatcatcaccatcacc
Adds BamHI and Gly-Ser-Ser upstream
Reverse primer gacgtcGCTAGCTTAaatatgagcatcgcccttgg
Adds stop codon (TAA) and NheI site downstream
Amplicon size 450 bp

PCRs for 6xHis-mCherry

PCR 5 — mCherry
Template BBa_J18932 (mCherry RFP)
Forward primer CACCATCATCACCATGTGAGCAAAGGCGAGGAAG
Adds 5xHis upstream
Reverse primer cgtatgGCTAGCTTATTTATACAGTTCATCCATGCCG
Adds stop codon (TAA) and NheI site downstream
Amplicon size 735 bp
PCR 6 — mCherry
Template Product of PCR5
Forward primer aattcgAAGCTTATGCACCACCATCATCACCATGTGAG
Adds HindIII, a start codon (ATG) and His upstream
Reverse primer cgtatgGCTAGCTTATTTATACAG
Keeps stop codon (TAA) and NheI site downstream
Amplicon size 753 bp

PCRs for mCherry-SpyTag

PCR 7 — mCherry-SpyTag
Template BBa_J18932 (mCherry RFP)
Forward primer CACCATCATCACCATGTGAGCAAAGGCGAGGAAG
Adds 5xHis upstream
Reverse primer accgatGGATCCtttatacagttcatccatgccg
Adds BamHI site downstream
Amplicon size 732 bp

Restriction Digests

Restriction digests for T7 expression backbone

Digest 1: Double-digest PCR1 product with NcoI and HindIII

Digest 2: Double-digest PCR2 product with NheI and NcoI

Restriction digests for sfGFP-SpyCatcher

Digest 3: Double-digest PCR3 product with HindIII and BamHI

Digest 3: Double-digest PCR3 product with HindIII and BamHI

Restriction enzymes used in our assembly
Restriction Enzyme Sequence Activity in NEBuffers (%) Incubation temperature Heat inactivation
1.1 2.1 3.1 CutSmart
AgeI A\CCGGT 100 75 25 75 37°C 65°C
AgeI-HF A\CCGGT 100 50 10 100 37°C 65°C
BamHI G\GATCC 75* 100* 100 100* 37°C
BamHI-HF G\GATCC 100 50 10 100 37°C
HindIII A\AGCTT 25 100 50 50 37°C 80°C
HindIII-HF A\AGCTT 10 100 10 100 37°C 80°C
HindIII A\AGCTT 25 100 50 50 37°C 80°C
HindIII-HF A\AGCTT 10 100 10 100 37°C 80°C
NcoI C\CATGG 100 100 100 100 37°C 80°C
NcoI-HF C\CATGG 50 100 10 100 37°C 80°C
NdeI CA\TATG 75 100 100 100 37°C 65°C
NheI G\CTAGC 100 100 10 100 37°C 65°C
NheI-HF G\CTAGC 100 25 10 100 37°C 80°C
* denotes star activity

Multi-Ligation

Ligating sfGFP-SpyCatcher

Ligating mCherry-SpyTag

Screening Transformants