Team:IISc-Bangalore/Assembly

Sponsors

Contact

1. BioBrick Transformations
2. Plasmid Isolation
3. PCRs
4. Restriction digests
5. Ligations
6. Screening

BioBrick Transformations

The five BioBricks we are using were transformed into E. coli strain DH5α — chosen for its recA and endA mutations that allow for high-yield minipreps.

BBa_K525998

BBa_K624004

BBa_K863200

BBa_K543020

BBa_K731721

Plasmid Isolation

Minipreps were performed from three colonies on each plate to confirm the presence of the plasmid. One colony from each positive transformants was used to make a glycerol stock.

INSERT GEL IMAGES

PCRs

Our assembly begins with our PCRs: using carefully-designed primers with 5'-overhangs, we add restriction sites, linkers and other features to our parts of interest. Since most of our PCRs have such overhangs, our annealing temperature changes after the first few cycles — our PCR cycle parameters account for this variation. In addition, we used NEB's Q5 MasterMix and NEB's Phusion polymerase, both high-fidelity DNA polymerases which have a higher annealing temperature than usual.

PCRs for the T7 expression backbone

PCR 1 — T7 Expression Backbone (Piece 1)
Template	BBa_K525998 (T7 promoter+RBS)
Forward primer	gactaccacggcatgatgaacctgaatcgc
	Amplifies the CmR gene, includes NcoI site
Reverse primer	gaattcAAGCTTtttctcctctttccctatagtgagtcg
	Adds HindIII site downstream
Amplicon size	886 bp

PCR 2 — T7 Expression Backbone (Piece 2)
Template	BBa_K731721 (T7 terminator)
Forward primer	gtatcacgaggcagaatttcag
	Keeps the NheI site
Reverse primer	gagaatatgtttttcgtctcagcc
	Splits the CmR gene, includes NcoI site
Amplicon size	1533 bp

PCRs for sfGFP-SpyCatcher

PCR 3 — sfGFP
Template	BBa_K1321337 (sfGFP in Freiburg format)
Forward primer	gaattcAAGCTTatgACCGGTcgtaaaggcgaagagctgttc
	Adds BBa_K2319001 (HindIII+ATG+AgeI scar) upstream
Reverse primer	gGAATTCggatccTGACCCTCCtttgtacagttcatccataccatg
	Adds Gly-Gly-Ser and BamHI site downstream
Amplicon size	753 bp

PCR 4 — SpyCatcher
Template	BBa_K1650037 (SpyCatcher)
Forward primer	GAATTAggatccGGGAGTAGCtcttattatcatcatcaccatcacc
	Adds BamHI and Gly-Ser-Ser upstream
Reverse primer	gacgtcGCTAGCTTAaatatgagcatcgcccttgg
	Adds stop codon (TAA) and NheI site downstream
Amplicon size	450 bp

PCRs for 6xHis-mCherry

PCR 5 — mCherry
Template	BBa_J18932 (mCherry RFP)
Forward primer	CACCATCATCACCATGTGAGCAAAGGCGAGGAAG
	Adds 5xHis upstream
Reverse primer	cgtatgGCTAGCTTATTTATACAGTTCATCCATGCCG
	Adds stop codon (TAA) and NheI site downstream
Amplicon size	735 bp

PCR 6 — mCherry
Template	Product of PCR5
Forward primer	aattcgAAGCTTATGCACCACCATCATCACCATGTGAG
	Adds HindIII, a start codon (ATG) and His upstream
Reverse primer	cgtatgGCTAGCTTATTTATACAG
	Keeps stop codon (TAA) and NheI site downstream
Amplicon size	753 bp

PCRs for mCherry-SpyTag

PCR 7 — mCherry-SpyTag
Template	BBa_J18932 (mCherry RFP)
Forward primer	CACCATCATCACCATGTGAGCAAAGGCGAGGAAG
	Adds 5xHis upstream
Reverse primer	accgatGGATCCtttatacagttcatccatgccg
	Adds BamHI site downstream
Amplicon size	732 bp

Restriction Digests

Restriction digests for T7 expression backbone

Digest 1: Double-digest PCR1 product with NcoI and HindIII

Digest 2: Double-digest PCR2 product with NheI and NcoI

Restriction digests for sfGFP-SpyCatcher

Digest 3: Double-digest PCR3 product with HindIII and BamHI

Digest 4: Double-digest PCR4 product with BamHI and NheI

Restriction digest for 6xHis-mCherry

Digest 5: Double-digest PCR6 product with HindIII and NheI

Restriction digests for mCherry-SpyTag

Digest 6: Double-digest Oligo 1 with HindIII and NdeI

Digest 7: Double-digest PCR7 product with NdeI and BamHI

Digest 8: Double-digest Oligo 2 product with BamHI and NheI

Restriction enzymes used in our assembly
Restriction Enzyme	Sequence	Activity in NEBuffers (%)				Incubation temperature	Heat inactivation
		1.1	2.1	3.1	CutSmart
AgeI	A\CCGGT	100	75	25	75	37°C	65°C
AgeI-HF	A\CCGGT	100	50	10	100	37°C	65°C
BamHI	G\GATCC	75*	100*	100	100*	37°C	—
BamHI-HF	G\GATCC	100	50	10	100	37°C	—
HindIII	A\AGCTT	25	100	50	50	37°C	80°C
HindIII-HF	A\AGCTT	10	100	10	100	37°C	80°C
HindIII	A\AGCTT	25	100	50	50	37°C	80°C
HindIII-HF	A\AGCTT	10	100	10	100	37°C	80°C
NcoI	C\CATGG	100	100	100	100	37°C	80°C
NcoI-HF	C\CATGG	50	100	10	100	37°C	80°C
NdeI	CA\TATG	75	100	100	100	37°C	65°C
NheI	G\CTAGC	100	100	10	100	37°C	65°C
NheI-HF	G\CTAGC	100	25	10	100	37°C	80°C
* denotes star activity

Multi-Ligation

Ligating sfGFP-SpyCatcher

Ligating mCherry-SpyTag

Screening Transformants