Guide RNA (gRNA)
- 1. gRNA 1 GCACTGCCCTGTGGATAACA - shows mild replication inhibition efficiency (Wiktor et al., 2016)
- 2. gRNA 2 TTGAGAAAGACCTGGGATCC - shows medium replication inhibition efficiency (Wiktor et al., 2016)
- 3. gRNA 3· GATCATTAACTGTGAATGAT - shows strong replication inhibition efficiency (Wiktor et al., 2016)
Name | Type | Type | Designer | Length |
---|---|---|---|---|
BBa_K2455000 | Basic Part | His-tagged AroG gene from E. coli MG1655 | 1092 | |
BBa_K2455001 | Basic Part | His-tagged TrpE gene from E. coli MG1655 | 1602 | |
BBa_K2455002 | Basic Part (Improvement of old) | R9-SYFP2-6His | 804 | |
BBa_K2455003 | Basic Part | Nona-Arginine with his-tag | 81 | |
BBa_K2455004 | Basic Part | YddG E. coli Tyr, Trp, Phe exporter | 885 | |
BBa_K2455005 | Basic Part (Improvement of old - Illegal) | R9-mTag BFP-6His | 786 | |
BBa_K2455007 | Basic Part (Composite) | YddG-TrpE construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455001) | 2513 | |
BBa_K2455008 | Basic Part (Composite) | YddG-AroG construct with an E. coli RBS between (BBa_K2455004 & BBa_K2455000) | 2005 |