Search results

Page title matches

Page text matches

  • <div class="title_extra" > Team Wiki </div> <p>Each team is given one poster slot, students must present the poster during the sched
    7 KB (1,018 words) - 23:42, 9 February 2017
  • ...ogo-vigne" src="https://static.igem.org/mediawiki/2017/f/fb/Ionis-paris-hp-team.jpg"></img> ...ogo-vigne" src="https://static.igem.org/mediawiki/2017/f/fb/Ionis-paris-hp-team.jpg"></img>
    19 KB (2,560 words) - 03:39, 2 November 2017
  • {{Template:Team:Tec-Chihuahua/header}} ...cutting-edge that can bring great success, as it can ease the plague. Our team is composed of Biotechnology undergraduates, and our product consists of a
    50 KB (7,497 words) - 02:31, 16 December 2017
  • ...ogo-vigne" src="https://static.igem.org/mediawiki/2017/f/fb/Ionis-paris-hp-team.jpg"></img> ...ogo-vigne" src="https://static.igem.org/mediawiki/2017/f/fb/Ionis-paris-hp-team.jpg"></img>
    19 KB (2,560 words) - 00:18, 2 November 2017
  • <li class="pure-menu-item"><a href="https://2017.igem.org/Team:NUDT_CHINA" class="pure-menu-link">HOME</a></li> <a class="pure-menu-link"onclick="Show('team_show')">TEAM</a>
    32 KB (4,019 words) - 03:44, 2 November 2017
  • <p>Before we started with this work in the lab, all team members had to pass different safety tests and receive training during an i ...for by thinking the experiments through beforehand. For this purpose, our team Safety Manager, Isabell Trinh, wrote safety proposals for our experiments.
    9 KB (1,440 words) - 10:45, 14 December 2017
  • {{Team:Bielefeld-CeBiTec/Head}} {{Team:Bielefeld-CeBiTec/Header}}
    41 KB (5,805 words) - 03:54, 2 November 2017
  • ...nces we found, to design the crRNAs for the <a href="https://2017.igem.org/Team:TUDelft/Design#cas13a" target="_blank">lab</a>. Furthermore, we checked the ...the dynamics of the transport of proteins (<a href="https://2017.igem.org/Team:TUDelft/Design#vesicles" target="_blank">TorA-GFP</a>) from the cytoplasm i
    69 KB (9,779 words) - 03:15, 2 November 2017
  • {{:Team:Edinburgh_UG/Templates/NavigationBar}} ...extensively explain how SSR occurs, using the popular Cre/Lox system as an example. </p>
    43 KB (4,680 words) - 23:05, 1 November 2017
  • <p>Below nomenclature at the example of <b><u>y</u>our <u>f</u>avorite <u>g</u>ene 1, <i>YFG1</i></b> is explain ...educated guesses which is first verified by <a href="https://2017.igem.org/Team:Cologne-Duesseldorf/Model#h2-1">molecular dynamics</a> and later experiment
    105 KB (15,409 words) - 02:56, 2 November 2017
  • PEX5 variant R3 with the PTS1 variant -YDSYD. This shows an example for a unfavorable result &minus; the receptor prefers the PTS1 above the PT ...variant with the PTS1 and the blue with the PTS1*. The figure above is an example for an unfavorable result &minus; one sees that wild type signal is prefere
    47 KB (6,978 words) - 15:22, 1 November 2017
  • {{:Team:Edinburgh_UG/Templates/NavigationBar}} ...rms with a high syllable count have no short and accurate substitutes. For example, “significance” has many
    24 KB (2,996 words) - 23:29, 1 November 2017
  • <p>Below nomenclature at the example of <b><u>y</u>our <u>f</u>avorite <u>g</u>ene 1, <i>YFG1</i></b> is explain ...educated guesses which is first verified by <a href="https://2017.igem.org/Team:Cologne-Duesseldorf/Model#h2-1">molecular dynamics</a> and later experiment
    98 KB (14,470 words) - 00:02, 2 November 2017
  • ...s page is focused on helping teams navigate through iGEM. Starting an iGEM team and getting a project started can be a challenge even for returning teams. <p>Students and instructors who are interesting in having an iGEM team for the upcoming season often begin preparing during November through Febru
    8 KB (1,380 words) - 19:41, 7 February 2017
  • ...but also consider creating a brochure in which you state the goals of your team. </p> ...doing and be careful to not overwhelm them. Having a team identity (logo, team color, presentation layout, etc.) will help you look professional and serio
    9 KB (1,470 words) - 04:10, 28 September 2017
  • .example {width:96%; margin-left:0px;} <h1><a name="jump_top">Team Members</a></h1>
    24 KB (2,992 words) - 03:25, 17 November 2017
  • {{Team:Hamburg/CSS}} <!--- {{Team:Hamburg/javascript/main}} --->
    12 KB (1,856 words) - 09:58, 1 November 2017
  • {{Team:Lethbridge_HS/normalizecss}} {{Team:Lethbridge_HS/reset}}
    9 KB (1,340 words) - 00:50, 2 November 2017
  • <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:DTU-Denmark/stylesheetsub?action=raw&ctype=text/css&?ver=6"> ...gh a documentary. A journalist is filming a documentary about our project, team, and the opportunities of synthetic biology.
    18 KB (2,533 words) - 23:27, 1 November 2017
  • <li><a href="https://2017.igem.org/Team:East_Chapel_Hill">Home</a></li> ...-toggle="dropdown" href="https://2017.igem.org/Team:East_Chapel_Hill/Team">Team
    12 KB (1,773 words) - 03:02, 2 November 2017
  • {{:Team:AHUT_China/Template/CSS_RESET}} ...n" class="navbar-toggle collapsed" data-toggle="collapse" data-target="#bs-example-navbar-collapse-1" aria-expanded="false">
    33 KB (4,524 words) - 03:37, 2 November 2017
  • nav.Unternavigation-Team{ <a href="https://2017.igem.org/Team:Tuebingen">
    20 KB (2,705 words) - 12:41, 12 December 2017
  • {{Team:Hamburg/CSS}} <!--- {{Team:Hamburg/javascript/main}} --->
    13 KB (1,925 words) - 15:23, 14 December 2017
  • <a href="https://2017.igem.org/Team:SCU_China">Home</a> <li><a href="https://2017.igem.org/Team:SCU_China/Repressilator">Repressilator</a>
    26 KB (2,514 words) - 00:25, 31 October 2017
  • <title>Team Michigan: Attributions</title> <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Michigan/CSS?action=raw&ctype=text/css" />
    22 KB (3,410 words) - 01:21, 2 November 2017
  • ...we were able to attend the symposium for one day with three people of our team. It gave us the opportunity to present our poster during the poster session ...the lecture, we had a discussion where everyone shared their opinions. For example, what changes would you make to our product design, would it be a problem f
    28 KB (4,313 words) - 03:16, 2 November 2017
  • <a href="https://2017.igem.org/Team:Mingdao" class="w3-bar-item w3-button w3-padding-large w3-white">Home</a> <a href="https://2017.igem.org/Team:Mingdao/Achievements" class="w3-bar-item w3-button w3-hide-small w3-padding
    173 KB (19,889 words) - 05:59, 15 December 2017
  • <a href="https://2017.igem.org/Team:Exeter"><img id="logo-top-left" width="100%;" src="https://static.igem.org/ <td><a href="https://2017.igem.org/Team:Exeter/HP/Silver">Human Practices</a></td>
    47 KB (7,519 words) - 03:19, 2 November 2017
  • ...erty</b>: an investor will want the system to be protected by a patent for example; and last but not least, to build a <b>complementary team</b> and <b>keep in mind that one day, the product will arrive in the custom
    39 KB (4,806 words) - 18:13, 1 November 2017
  • <script type="text/javascript" src="https://2017.igem.org/Team:CCU_Taiwan/assets/js/js_anchor? <script type="text/javascript" src="https://2017.igem.org/Team:CCU_Taiwan/assets/js/js_anchor_show?
    66 KB (10,210 words) - 03:40, 2 November 2017
  • <td><ul><li>Risk Group 1 microorganisms <br /> (For example: <i>E. coli</i> K-12, <i>S. cerevisiae</i>, <i>B. subtilis</i>, <i>Lactobac <td><ul><li>Risk Group 2 microorganisms <br /> (For example: <i>Pseudomonas</i> spp.)</li></ul></td>
    12 KB (2,053 words) - 16:06, 28 June 2017
  • {{Team:BostonU_Hardware/CSS}} ...e PDMS layer in order to manipulate fluid flow through the flow layer. For example, by actuating a syringe attached to the control layer, a valve can be opene
    23 KB (2,954 words) - 02:10, 1 November 2017
  • <a href="https://2017.igem.org/Team:Peking"><img <a class="mdl-navigation__link" href="https://2017.igem.org/Team:Peking"
    170 KB (16,709 words) - 06:32, 15 December 2017
  • <a href="https://2017.igem.org/Team:Aalto-Helsinki/Story">Story</a><br> <a style="text-decoration: underline" href="https://2017.igem.org/Team:Aalto-Helsinki/Dialog">Dialog</a><br>
    22 KB (3,543 words) - 20:36, 11 December 2017
  • <p style="font-size: 18px;">Fig2 The team member is introducing the three elements in Synthetic Biology.</p> ...">To demonstrate the concept of logic gate, we made some extension to this example. Logical processing, the application of logic gates, might increase the acc
    13 KB (1,852 words) - 01:52, 20 November 2017
  • <!-- Remember the (Alamo) Template:Team:Dartmouth/etc --> {{Team:Dartmouth/DiGEM17_Style}}
    6 KB (811 words) - 02:52, 2 November 2017
  • ...ls.io/ protocols.io’s API], another protocol database, and contacted the team there to try and get access to the public protocols without the user’s lo ...ry difficult to parse automatically. We talked with [https://2017.igem.org/Team:Michigan_Software/HP Michigan Software], who are looking into standardising
    9 KB (1,394 words) - 21:59, 27 October 2017
  • <link rel="stylesheet" href="https://2014.igem.org/Team:Aalto-Helsinki/bootstrap.min.css?action=raw&amp;ctype=text/css" type="text/ <link rel="stylesheet" href="https://2014.igem.org/Team:Aalto-Helsinki/stylesheet.css?action=raw&amp;ctype=text/css" type="text/css
    11 KB (1,332 words) - 14:15, 31 October 2017
  • ...team SDU_CHINA. We’d like to appreciate professor Yuan and her research team members here! </p> ...is responsible for organizing some activities, such as meet-up activity of team members, propagation iGEM at school campus.</p>
    6 KB (1,040 words) - 04:37, 22 October 2017
  • <p>Biocon's R&D park, located in Bangalore, hosted four members of our team who toured the facility and spoke to the Manager of the R&D division to und ...erest in industrial processes, leading to a <a href="https://2017.igem.org/Team:IISc-Bangalore/HP/Gold_Integrated">more fruitful collaboration</a> with ind
    9 KB (1,394 words) - 02:38, 2 November 2017
  • ...team SDU_CHINA. We’d like to appreciate professor Yuan and her research team members here! </p> ...is responsible for organizing some activities, such as meet-up activity of team members, propagation iGEM at school campus.</p>
    7 KB (1,072 words) - 00:43, 2 November 2017
  • ...team SDU_CHINA. We’d like to appreciate professor Yuan and her research team members here! </p> ...is responsible for organizing some activities, such as meet-up activity of team members, propagation iGEM at school campus.</p>
    6 KB (1,040 words) - 02:11, 8 October 2017
  • {{Team:Macquarie_Australia/Templates/Menu}} <center>{{Team:Macquarie_Australia/Templates/NavBar}}</center>
    16 KB (2,426 words) - 04:03, 1 November 2017
  • xlink:href="https://2017.igem.org/Team:Lund/GoGreen" xlink:href="https://2017.igem.org/Team:TU_Dresden/HP/Gold_Integrated"
    80 KB (7,755 words) - 01:27, 2 November 2017
  • ...g camps to children of all age throughout the elementary summer break. Our team constructed a syllabus, filled with hands-on STEM related activities, as we actively involved and receptive to more and more advanced activities. An example of some activities is provided below.</p>
    17 KB (2,652 words) - 02:49, 2 November 2017
  • <a href='https://2017.igem.org/Team:NTNU_Trondheim'> <a href='https://2017.igem.org/Team:NTNU_Trondheim/Safety'>
    18 KB (1,780 words) - 03:14, 2 November 2017
  • ...ion is to build a strong and long-lasting community to support the current team, and to ensure the future participation of Stockholm in iGEM. </p> ...account which is inherited by every new team, making it easier for the new team to start raising its first - and very necessary - money. </p>
    2 KB (366 words) - 21:36, 5 December 2017
  • <title>Team:BGIC-Union</title> <link href="https://2017.igem.org/Team:BGIC-Union/finalcss/main-css?action=raw&amp;ctype=text/css" rel="stylesheet
    35 KB (4,728 words) - 02:43, 1 November 2017
  • {{:Team:SUSTech_Shenzhen/removeStyles}} {{:Team:SUSTech_Shenzhen/nav}}<!--------子页面导航栏-------------------------
    6 KB (806 words) - 16:46, 14 December 2017
  • {{:Team:Manchester/Templates/NavBar}} ...research made by Martin Warren et al. as documented in the 2017 paper. Our team are planning to target WWTPs in Canada specifically, as we believe it is th
    30 KB (4,429 words) - 23:38, 1 November 2017
  • <a href="#">TEAM</a> <li><a href="https://2017.igem.org/Team:SZU-China/Team">MEMBERS</a></li>
    38 KB (4,604 words) - 02:39, 2 November 2017
  • {{Team:William_and_Mary/CSS_RESET}} {{Team:William_and_Mary/CSS_FIX}}
    19 KB (2,797 words) - 03:07, 15 December 2017
  • {{Template:Team:Tec-Chihuahua/header}} ...biofilm and encouraging the motility. For this last virulence factor, the team proposes to arrest flagellar rotation with a Putative Glycosyltransferase e
    14 KB (2,115 words) - 01:08, 2 November 2017
  • ...ic biology and our project. We explained it as simply as possible using an example of a light switch to explain toehold switches to younger students. For olde ...his by having several different colour fluorescent (glowing) proteins. For example, not just a green one but also red, orange, blue and purple ones. We could
    11 KB (1,720 words) - 23:15, 31 October 2017
  • {{Team:Hamburg/CSS}} <!--- {{Team:Hamburg/javascript/main}} --->
    32 KB (4,998 words) - 06:18, 24 November 2017
  • <li>Collaborated with the University of Toronto iGEM team to design the sgRNA for their project.</li> ...genes</i> CRISPR/Cas9 can only bind and cut locations with a PAM site. For example, CRISPR/Cas9 with a guide sequence of ATGCTTACGTAGCTCCATGT could could bind
    18 KB (2,932 words) - 03:36, 2 November 2017
  • {{Team:Hamburg/CSS}} <!--- {{Team:Hamburg/javascript/main}} --->
    19 KB (2,783 words) - 22:31, 14 December 2017
  • ...e. Dimensions of a feature space depends on the scale of your dataset. For example, if you have twenty-six groups of data, you form a twenty-six dimensional f ...ng based logistic regression. From a high school IGEM participant's scope, team HFLS_H2Z will show you the difference between these models and the scope of
    18 KB (2,524 words) - 03:03, 2 November 2017
  • ...t is basically a text document with some additional styling. The following example shows the minimal website:</p> ...the possibility to build your wiki page backbone in a way that your other team members cannot overwrite it by accident. We will cover how in the CSS secti
    18 KB (2,956 words) - 15:54, 23 September 2017
  • ...s, it would be great to try and incorporate this into their treatment. For example if there is a farm which we know has a resistance problem <p>As a team we had previously never considered using PhagED as a powder to add to food,
    44 KB (7,119 words) - 03:42, 2 November 2017
  • <p align="left">Create a page on your team wiki with clear attribution of each aspect of your project. This page must ...any other registered iGEM team in a meaningful way. For example, mentor a team, characterize a part, troubleshoot a project, model/simulate a system or va
    21 KB (3,342 words) - 02:19, 30 May 2017
  • ...feedback that we provided for the Purdue Biomakers, please visit Purdue's team Wiki!</h4> ...? Discussing these points proved crucial in navigating our first year as a team, and Purdue's shared materials and discussions helped us greatly. </p><br>
    6 KB (986 words) - 13:50, 28 September 2017
  • <p align="left">Create a page on your team wiki with clear attribution of each aspect of your project. This page must ...any other registered iGEM team in a meaningful way. For example, mentor a team, characterize a part, troubleshoot a project, model/simulate a system or va
    21 KB (3,342 words) - 17:16, 22 July 2017
  • our project. The iGEM-team from Aachen of 2015 already built Do-It-Yourself peristaltic pumps based on The pumps of the 2015 team were designed for continuous pumping in a bioreactor, where they did a grea
    30 KB (4,195 words) - 00:12, 16 December 2017
  • <!-- Remember the (Alamo) Template:Team:Dartmouth/etc --> {{Team:Dartmouth/DiGEM17_Style}}
    6 KB (810 words) - 04:29, 29 October 2017
  • <li><a href="https://2017.igem.org/Team:Stony_Brook">Home</a></li> <a href="#">Team</a>
    11 KB (1,606 words) - 01:04, 2 November 2017
  • {{:Team:Valencia_UPV/Templates:fonts}} {{:Team:Valencia_UPV/Templates:bootstrap}}
    41 KB (5,363 words) - 03:07, 2 November 2017
  • <title> TEAM </title> ...). Also, some parts of the protocol were done in kit-like conditions. For example, steps for which liquids had to go through a silica membrane were done than
    28 KB (3,982 words) - 18:22, 29 October 2017
  • The iGEM Team NAWI_Graz looked for different possibilities to collaborate with other team ...arlier, smaller version of the Giant Jamboree in Europe excited the whole team and we decided to send seven people to the Netherlands to get in touch with
    10 KB (1,513 words) - 03:02, 2 November 2017
  • <li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...le="dropdown" href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team
    11 KB (1,569 words) - 22:03, 27 October 2017
  • <title>Team:HFUT-China</title> <a href="https://2017.igem.org/Team:HFUT-China">&nbsp;&nbsp;Main page&nbsp;&nbsp;</a>
    23 KB (2,323 words) - 01:11, 2 November 2017
  • ...ology association organizes the Netherlands Biotechnology Conference. iGEM team Eindhoven, other iGEM teams and several other researchers were present to s ...an iGEM team presented ourselves to the students-to-be about iGEM and iGEM team Eindhoven. We did this to make them aware of the possibility to join future
    15 KB (2,567 words) - 17:17, 1 November 2017
  • <li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...le="dropdown" href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team
    11 KB (1,572 words) - 21:54, 27 October 2017
  • <li ><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...<li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team </a></li>
    9 KB (1,356 words) - 21:02, 25 October 2017
  • <li ><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...<li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team </a></li>
    9 KB (1,357 words) - 21:10, 25 October 2017
  • <li ><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...<li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team </a></li>
    9 KB (1,357 words) - 21:11, 25 October 2017
  • <li ><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...<li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team </a></li>
    9 KB (1,344 words) - 03:47, 31 October 2017
  • ...r"><em>Carlos Urzua, in colaboration with the iGEM team Groningen and iGEM team MIT</em></h4> ...number #26). We, at the Groningen team decided to collaborate with the MIT team by doing this analysis.</p>
    712 KB (88,923 words) - 16:59, 26 October 2017
  • {{:Team:Valencia_UPV/Templates:fonts}} {{:Team:Valencia_UPV/Templates:bootstrap}}
    30 KB (3,986 words) - 08:32, 5 December 2017
  • <a href='https://2017.igem.org/Team:NTNU_Trondheim'> <a href='https://2017.igem.org/Team:NTNU_Trondheim/Safety'>
    20 KB (2,075 words) - 03:13, 2 November 2017
  • ...acuum. This year marked extensive development for mGEM’s Human Practices team, as we sought to address the gap between our project’s lab work and the t <p>The Human Practices team spoke with Dr. Dominik Mertz on August 2nd, 2017. Dr. Mertz is an associate
    33 KB (5,274 words) - 03:52, 2 November 2017
  • <li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...le="dropdown" href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team
    11 KB (1,567 words) - 21:49, 27 October 2017
  • {{:Team:UChile OpenBio-CeBiB/Template/2}} {{:Team:UChile_OpenBio-CeBiB/Template/bg}}
    69 KB (10,880 words) - 03:57, 2 November 2017
  • {{Team:TUST_China/TUST_meau}} {{Team:TUST_China/CSS/HP}}
    13 KB (1,387 words) - 02:41, 1 November 2017
  • ...no-shadow" src="https://static.igem.org/mediawiki/2017/f/fb/Ionis-paris-hp-team.jpg"></img> ...no-shadow" src="https://static.igem.org/mediawiki/2017/f/fb/Ionis-paris-hp-team.jpg"></img>
    72 KB (9,335 words) - 00:52, 2 November 2017
  • {{Example}} <p>This page is used by the judges to evaluate your team for the <a href="https://2017.igem.org/Judging/Medals">medal criterion</a>
    4 KB (610 words) - 18:59, 26 March 2018
  • ...ic biology to the public. Although GMOs hold many possibilities in, for an example, future medication and fuels, we are also aware of the concerns regarding The team together with the volunteers. Photographer: Patrik Sanila
    17 KB (2,709 words) - 17:32, 8 December 2017
  • <p>The expansion of mGEM’s Human Practices team this year allowed us the resources to integrate discussions of safety and r ...eatment process. This “standard” document helped to anchor the Wet Lab team in the current discovery climate, and revealed gaps (including efficiency a
    7 KB (1,096 words) - 03:49, 2 November 2017
  • ...rom Iron(II) ion concentrations in saliva to amilCP concentrations for our team’s system. We first had to decide whether we should model our final cell-f ...f finding appropriate values for time, FURt and DNA become feasible. As an example, here is a graph of varying FURt values.</p><p><br></p><p>
    49 KB (7,597 words) - 23:23, 14 December 2017
  • ...go. We also elaborated caps with logo for ZJU-China, our fellow collegiate team. ...tivity for children at Zhejiang Science and Technology Museum with another team from Zhejiang University. We designed various games and experiments which i
    25 KB (3,627 words) - 03:11, 2 November 2017
  • {{Team:William_and_Mary/CSS_RESET}} {{Team:William_and_Mary/CSS_FIX}}
    13 KB (1,941 words) - 03:39, 2 November 2017
  • {{:Team:NTHU_Taiwan/MenuBar}} ...out what the world lacks and to dedicate our ability to the needs. In our team, the cares of the environment and human health are the ultimate goals. The
    28 KB (4,286 words) - 16:11, 1 November 2017
  • {{Team:Cadets2Vets/SideMenu}} <link href="https://2017.igem.org/Team:Cadets2Vets/css/common?action=raw&ctype=text/css" rel="stylesheet">
    101 KB (11,918 words) - 03:42, 1 November 2017
  • {{Team:Lethbridge/assets/reset.css}} {{Team:Lethbridge/assets/sidemenuremove.css}}
    28 KB (4,404 words) - 23:49, 1 November 2017
  • <title>2017.igem.org/Team:XMU-China/Project</title> <link href="https://2017.igem.org/Http://2017.igem.org/Team:XMU-China/css/unitcommomCss?action=raw&ctype=text/css" rel="stylesheet" typ
    7 KB (1,038 words) - 12:47, 27 October 2017
  • {{:Team:Valencia_UPV/Templates:fonts}} {{:Team:Valencia_UPV/Templates:bootstrap}}
    24 KB (3,060 words) - 03:24, 2 November 2017
  • ...rrey_GDA/HP/Silver">Silver</a> page and our <a href="https://2017.igem.org/Team:TecMonterrey_GDA/Project/Justification">Project Justification</a>.</p> <div class="p-2"><h4>1.- Formation of the team<h4></div>
    14 KB (2,347 words) - 03:31, 2 November 2017
  • <h2><a href="https://2017.igem.org/Team:Macquarie_Australia"> Team Macquarie </a></h2> <p>Team Macquarie had constructed a hydrogenase gene capable of converting glucose
    12 KB (1,966 words) - 02:40, 2 November 2017
  • <a href="https://2017.igem.org/Team:USTC" class="waves-effect waves-teal">Home</a> <li class="bg_all"><a href="https://2017.igem.org/Team:USTC/Description">Description</a></li>
    27 KB (2,696 words) - 13:00, 1 November 2017
  • {{:Team:SUSTech_Shenzhen/removeStyles}} {{:Team:SUSTech_Shenzhen/themeCss}}
    8 KB (1,293 words) - 03:56, 2 November 2017

View (previous 100 | next 100) (20 | 50 | 100 | 250 | 500)