Difference between revisions of "Team:British Columbia/crispr"

Key Achievements

Fundamentals

CRISPR is a novel system that allows us to alter genes with unprecedented precision and accuracy. CRISPR, which stands for Clustered Regularly Interspaced Palindromic Repeats, comes in many flavours all with unique abilities to modify organism as we see ethically fit. The most commonly known CRISPR subtype is Cas9, an endonuclease, that causes double strand DNA breaks. In essence, CRISPR is the vaccination machinery of a bacterium, containing short sequences derived from foreign genetic elements and causing cleaving and degradation of potential threats. These short sequences are transcribed into RNA, typically 20 base pairs long, that bind to the Cas9 enzyme guiding it to a complementary sequence and cleave it. The CRISPR/Cas system has been modified for gene editing, and it has become a widely used tool for both medical and biological researchers. The most widely used variant of the CRISPR systems is CRISPR/Cas9, which is performed by transfecting cell with the Cas9 and a single-guide RNA (sgRNA).

The sgRNA is a simpler version of the CRISPR RNA, which is constituted by fusing a conserved RNA sequence and a target-complementary sequence. Normally, the target-complementary sequence will be 20 base pairs in length. For each target sequence, a protospacer adjacent motif (PAM site) is required to facilitate Cas9 protein binding to the target DNA. The PAM sequences are specific to the enzymes and are required for successful DNA cleavage; for S.pyogenes CRISPR/Cas9, the CRISPR variant British_Columbia uses, the PAM site is 5’ - NGG - 3’. The popularity of the CRISPR/Cas9 approach has resulted in a variety of software tools to design guide RNA, this normally take into account non specific targeting which could have major implications on your experimental approach.

The ability of CRISPR/Cas9 to edit the genome relies on the double stranded break repair pathway of its host organism. Normally eukaryotic cells are able to undergo double stranded break repair through two major pathways: Non Homologous End Joining Repair (NHEJ), and Homologous Repair (HR). In some prokaryotes like Agrobacterium, HR is the dominant approach. HR is only successful upon the presence of donor DNA, when this is absent the double stranded break results in lethality for the organism or plasmid curing by causing degradation of the targeted DNA.

Project Background

Agrobacterium strains only exhibit the ability to infect plants when it hosts the Ti plasmid, which gives it the molecular tools necessary to transform plant cells. The integration of the transfer-DNA (T-DNA) segment from the Ti plasmid into the plant genome causes a persistent and chronic infection, which will lead to the formation of a tumour, otherwise known as Crown Gall.

The machinery that is involved in the injection of this T-DNA is present as the vir operon within the Ti plasmid. In theory, using our CRISPR/Cas9 system to target a gene within this operon would render the Agrobacterium non-pathogenic, while keeping the cell viable. Since the Ti plasmid is kept at a low copy number, and it comes with a high metabolic cost without a plant host, there will be a low rate of homologous recombination. Thus, the Ti plasmid would be degraded. If recombination does occur, a contingent strategy is required. To ensure the vir operon has been disabled, a second CRISPR/Cas9 target can included into the system. The guides will continue to cut the targeted sites until the guide sequences no longer exists inside the cell, either neutralizing the targeted gene entirely or curing the Ti plasmid.

We decided to target the VirD2 gene, given its essential role in pathogenesis and degree of conservation in Ti plasmids. This VirD2 gene is involved in a complex that cleaves off the T-DNA from the Ti plasmid and transports it into the transfer machinery to inject it into a plant cell. Without the VirD2 gene, T-DNA cleavage from the Ti plasmid is highly unlikely, leading to the inability to transform plants.

There are two kinds of Cas9 proteins, the enzymatically active Cas9 and the enzymatically ‘dead’ Cas9 (dCas9). One of the application of dCas9 is the inhibition of gene expression, by preventing RNA polymerases from reading the gene. Therefore, dCas9 battles between being bound and unbound to its target gene, leading to background expression levels of a gene. If we wanted to eliminate all possibility of infection, we had to rely on Cas9’s endonuclease activity to cut and degrade the Ti plasmid.

The backbone of our Cas9 construct was a pCAMBIA vector, which has the ability to replicate within E. coli and Agrobacterium. This vector is commonly used for plant genome transformation, similar to a Ti plasmid surrogate. We cloned in our Cas9 gene and our sgRNA downstream to the Cas9 gene, into our modified pCAMBIA-MCS vector. A common method used in CRISPR/Cas9 research is having the sgRNA and Cas9 coding sequences in separate plasmids. However, this did not seems optimal for the purposes of our experiments since the probability of a sgRNA and a Cas9 plasmid to be conjugated into the same cell would be lower than if both were present in the same plasmid. Naturally, all the cloning work was performed initially into E. colisince it allowed us to work in a better understood organism and led to higher copy numbers of our construct.

Project Strategy

Our final construct, pGUIDE, consisted of Chloramphenicol and Kanamycin resistance genes, the Cas9 gene, an sgRNA gene regulated by a tetracycline operator, and plasmid maintenance genes initially included on the plasmid backbone. We started our cloning by using the pCAMBIA plasmid, which contained the necessary genetic components to replicate in E. coli and Agrobacterium. It also housed the Kanamycin resistance gene under a constitutive promoter. In our first round of cloning with our pCAMBIA plasmid, we noticed that there was a segment of DNA present in the plasmid that was not annotated. We identified this segment since our digest fragments were shifted by one kilobase pairs when running a gel. This was most likely due to the the plasmid’s use in plant transformation. To work around this unknown component, we added a Multi-Cloning Site, and sequenced confirmed its presence.

Our pCAMBIA-MCS plasmid allowed us to have greater certainty that our Cas9 would be successfully cloned in. We probed the sequence of both the MCS sequence of our pCAMBIA-MCS and pCas9-CR4 plasmid to find shared unique restriction enzyme cut sites in both plasmids. One of our goals was to keep both the selection markers in the plasmid. pCAMBIA-MCS marker is Kanamycin, while pCas9-CR4 is Chloramphenicol. We discovered that SpeI and SacII would provide us with the desired result. Given that our pCAMBIA-Cas9 plasmid contained two antibiotic resistant genes, we could be sure that the colonies grown in LB + Kan + Cm plates were successful clonings. To be more thorough with our results, we sequenced confirmed the presence of Cas9 in our plasmid.

Our next goal was to clone in the sgRNA gene blocks that our modelling team generated. Prior to synthesis of sgRNA sequence, added two flanking RE cut sites to the sgRNA. To identify the optimal cut sites, we searched our pCAMBIA-Cas9 plasmid for unique cut sites downstream of our Cas9 gene. SpeI and PstI were decided us our ideal cut sites.

To address potential plasmid recombination, we decided to recruit two sgRNA in one pGUIDE plasmid. Due to synthesis limitations, we could not order a gene block containing two sgRNA. Therefore, we decided on ordering the sgRNA in separate fragments flanked with either SpeI - HindIII, HindIII - PstI, or PstI - HindIII, depending on the desired combination. After ligating the sgRNAs at the HindIII cut site, we would clone them into our pCAMBIA-Cas9 plasmid using SpeI and PstI cut sites, creating our dual pGUIDE.

For pGUIDE, both the Cas9 and sgRNA constructs are under control of tetracycline induction. The incentive for having both under control of the same inducer is to minimize the variability of sgRNA and CRISPR concentration. For an environmental application, the CRISPR/Cas9 system would be under control of an environmental inducer, however, the inducible promoters used for other functions in Agrobacterium were not experimentally characterized well enough to perform our CRISPR/Cas9 validation. Our team’s related work on inducible Agrobacterium promoters can be seen here.

Once our pGUIDE plasmid was formed, having all the components described earlier, the plasmid was transformed into Agrobacterium through electroporation.

Guide RNA Design

CRISPR/Cas9 targets DNA through complementary sequences between a single-guide RNA and a DNA strand. One of the main concerns surround CRISPR technologies is the potential for off-targets, which are when a sgRNA has multiple specificities. Naturally, our goal was to limit the number of off-targets one sgRNA would have. With this aim, our team developed a model based on a bioinformatic and physical chemical approach in order to find the sgRNA sequences with the fewest off target events. More information on the model can be found here.

Our energy based sgRNA model was used to design the sgRNA for our system. To confirm that the Agrobacterium strain we used contained this plasmid, testing with common agrobacterium antibiotics was performed: our Agrobacterium grew successfully in gentamicin and rifampicin, identifying it as a Agrobacterium strain containing a TiC58 variant, instead of an Ach5 Ti plasmid. With this information, we opted to use the TiC58 plasmid sequence, which we noted as the standard in the field. We wanted our CRISPR/Cas9 to display functionality in multiple strains with virD2 targets. There were differences between the virD2 on the TiC58 and the Ti Ach5, so the model was run with both variants, finding all potential guides for both plasmids. The gene sequences input into the model for the TiC58 plasmidtargeting can be accessed at www.ncbi.nlm.nih.gov and are as follows: Agrobacterium tumefaciens str. C58 linear chromosome (AE007870.2), Agrobacterium tumefaciens str. C58 circular chromosome (AE007869.2), Agrobacterium tumefaciens str. C58 plasmid Ti (AE007871.2), Agrobacterium tumefaciens str. C58 plasmid At (AE007872.2), pCambia1305.1 (http://www.snapgene.com/resources/plasmid_files/plant_vectors/pCAMBIA1305.1/), pCas9-CR4 (https://www.addgene.org/62655/), and the gene input was the VirD2 region in the TiC58 plasmid. For targetting the Ach5 Ti plasmid, the genome files used were ASM97156v1 (https://www.ncbi.nlm.nih.gov/assembly/GCF_000971565.1), along with pCambia1305.1, pCas9-CR4, and the gene input was the VirD2 region from the Ach5 Ti plasmid.

Guides from both Ti plasmids were ranked based on their partition functions and the sequences were compared to determine guides compatible with both strands. When determining compatibility between sequences, the five nucleotides next to the PAM site were required to be homologous, as these nucleotides are most important for Cas9 binding. From the pool of homologous sgRNA obtained from both Ti plasmid sequence, cross-referenced with the Agrobacterium genome, we selected the three sgRNA sequences: CGATATTGGGCATAAGTGAT with a partition function of 84.902, AGGCCGTAAGATAGTTGTAT with a partition function of 84.489, and TCAACAAATTATCAATCAGT with a partition function of 73.445. With these guides, CRISPR/Cas9 experiments could be performed in Agrobacterium to target the VirD2 gene and test effectiveness of our construct.

CRISPR/Cas9 Toxicity in Agrobacterium tumefaciens

An important facet of our CRISPR/Cas9 system is the effects of the Cas9 protein in the Agrobacterium. Whenever there is exogenous expression of a protein, it is crucial to identify any inherent toxicity or phenotype that our protein may present in its new host. Therefore, one of our goals was to characterize any deleterious, toxic, effects that Cas9 may have on Agrobacterium.

Currently, we have not been able to find literature that has attempted to demonstrate Cas9’s effect on growth. Therefore, we designed an assay to quantitatively measure its effect at varying levels of induction. Moreover, our Cas9’s expression is induced by anhydrotetracycline, a common effector used in eukaryotic genetic engineering. Anhydrotetracycline is a derivative of tetracycline, which is known to be a bacteriostatic effector. Therefore, we implemented a similar assay to quantify the effect of anhydrotetracycline on Agrobacterium growth rate.

Cultures of Agrobacterium tumefaciens GV3101 with and without pCambia-Cas9 were inoculated 24 hours before the start of the assay in 5 mL of LB media with 10 µg/mL Rifampicin and 50 µg/mL Kanamycin at 30°C. After 24 hours, cultures were diluted to 0.100 OD600, induced with anhydrotetracycline at 0 ng/mL (control), 21 ng/mL, 42 ng/mL or 84 ng/mL and incubated on a shaker at 30°C and 220 rpm. OD600 values were measured with a spectrophotometer at 0, 1, 2, 8 and 24 hours after addition of anhydrotetracycline.

Anhydrotetracycline slowed growth regardless of pCambiaCas9 plasmid presence, but cultures with the plasmid were slowed to a greater extent. Higher doses of anhydrotetracycline showed increasing growth inhibition at all time points. From 0 hours to 8 hours, Agrobacterium without pCambiaCas9 and 42 ng/mL anhydrotetracycline had the least inhibition, but did not recover as well as other conditions after 24 hours.

The purpose of this assay was to determine whether Cas9 induction or anhydrotetracycline itself would be toxic to Agrobacterium. The results indicate that both of these factors slow growth, but are not conclusively cytotoxic. It was expected that cultures harboring pCambiaCas9 would grow more slowly than those without, because they must commit to synthesizing Cas9 proteins in addition to their normal metabolism. Anhydrotetracycline also slowed growth in cultures that did not have any plasmids, which shows evidence of some other inhibitory effect on cellular growth aside from metabolic burden. It follows logically that increasing concentrations of the inducer had a greater effect. Despite modest levels of growth inhibition, we know from this assay that anhydrotetracycline is a viable inducer for Cas9 in Agrobacterium for future experiments.

This preliminary test for Cas9 toxicity occurred before we had successfully cloned our final CRISPR/Cas9 constructs with sgRNAs included, so it is important that we repeat a toxicity assay with the sgRNAs included.