British_Columbia_Base

Overview

Toxin-antitoxin systems are widespread throughout the prokaryotic world. Typically the systems are composed of two genes: toxin and antitoxin, where the toxin is more stable than the antitoxin but the latter is expressed to a higher level. (Melderen & De Bast, 2009) Toxin-antitoxin systems provide a selective pressure on plasmid maintenance, as plasmid loss leads to the loss of supply of the antitoxin which then can no longer counteract the effect of the toxin. Consequently, the toxin is activated and can act on the bacterial cell killing it. (Unterholzner, Poppenberger, & Rozhon, 2013) In the system we have chosen, ietAS, literature searches have revealed that the antitoxin ietA is similar to an AAA-ATPase and the toxin ietS is similar to subtilisin-like serine proteases. (Yamamoto et Al., 2009) Therefore the killing mechanism for our system is thought to be proteolysis although further characterization is needed and ongoing.

In the aGROW system, the CRISPR-Cas9 system targeting Agrobacterium tumefaciens virulence factors adds metabolic burden to a cell, therefore the plasmid carrying Cas9 may get lost from the population. To counter this and ensure plasmid maintenance, we have employed a toxin-antitoxin native to Agrobacterium tumour inducing plasmids. The toxin-antitoxin system we have used is native to the pTIC58 plasmid and is essential for high level incompatibility with other plasmids of the repABC family as well as contributing to the general stability of the plasmid.

Key Achievements

Biobricked ietA (antitoxin), ietS (toxin), and ietAS (toxin antitoxin)
Subcloned ietAS into pCAMBIA plasmid
Characterized ietAS toxin antitoxin complex in Agrobacterium to compare plasmid loss

Design

After an extensive literature search we identified ietA ietS toxin-antitoxin system, originally identified by Yamamoto et Al., as our main candidate for plasmid maintenance in Agrobacterium. As the two regions were fairly large and we were not working with the wild type strain of Agrobacterium that carries the pTiC53 plasmid, we decided to synthesize them as IDT gBlocks.

The genes are part of an operon and we kept them under the native promoter. The two fragments we ordered were ietA which consisted of the nucleotides between position 97,533 and 98859 in GenBank AE007871.2 and ietS which consisted of the nucleotides between position 98863 and 101373 in GenBank AE007871.2. In order to biobrick our fragments we ordered the gBlocks with the bio bricking suffix and prefix flanking the edges. We also removed internal Eco-RI, Xba-I, Spe-I, and Pst-I cutsites by changing interchanging codons using this codon usage chart for Agrobacterium .

To have a construct work in Agrobacterium we needed to use a plasmid that could replicate efficiently in Agrobacterium. We chose pCambia 1305.1 a standard plasmid used for Agrobacterium mediated plant transformation. For our purposes we only wanted to use the plasmid’s backbone which included: KanR, a Kanamycin resistance cassette, ori a high copy number pUC origin of replication for E. coli, bom a basis of mobility from pBR322, pVS1 oriV origin of replication for Agrobacterium, pVS1 RepA, and pVS1 StaA. We also wanted to insert a multicloning site (MCS) to our design which we ordered as a gBlock from IDT. The sequence for our MCS was: GCGTTCCGCGGGTTCTTAAGGTTCTCGAGGTTAAGCTTGTTAGATCTGTTGAATTCGCGGCCGCTTCTAGAGTACTAGTAGCGGCCGCTGCAGGT TGGATCCGTTCCATGGGTTGCATGCGTTCG.

Methods

The strains used were Agrobacterium tumefaciens GV3101 and Escherichia coli DH5-Alpha unless otherwise stated. All E. coli cultures were grown in LB media at 37℃ unless otherwise stated. All Agrobacterium were grown in LB at 30℃ unless otherwise stated. All plasmid DNA extractions were performed with ABM Column-Pure Plasmid Mini-Prep Kit. DNA purification from gels with ABM Column-Pure DNA Gel Recovery Kit. The same protocols for DNA gel electrophoresis, restriction enzyme digest, DNA ligation, and chemical and electro transformation were used throughout unless otherwise stated and can be found in Protocols.

Cloning ietAS into psb1c3

Cloning ietAS into pSB1C3 was done in two consecutive rounds of standard restriction enzyme cloning. The ietA and ietS gBlocks ordered from IDT and pSB1C3 were digested with Eco-RI and Spe-I enzyme. The two pieces of pSB1C3 were separated and purified by gel purification. pSB1C3 was ligated with ietA and ietS in two separate ligation reaction overnight. The resulting ligations were then transformed into chemically competent E. coli. Transformants were picked 24 hours later and grown overnight in LB-Chloramphenicol. Overnight cultures were miniprepped and checked by restriction enzyme digest using Eco-RI and Pst-I enzymes, transformants identified with the right size band (1.3 kB for ietA and 2.5 kB for ietS) were checked by Sanger sequencing using VF2 and VR primers.

To combine the two constructs and place ietA upstream of ietS, pSB1C3 ietS was digested using Eco-RI And Xba-I enzymes and pSB1C3 ietA was digested using Eco-RI and Spe-I. Both digests were separated and purified by gel electrophoresis and gel clean up kits. The ietA fragment was ligated with the pSB1C3 fragment to form a the full ietAS construct. The resulting ligation was then transformed into chemically competent E. coli. Transformants were picked 24 hours later and grown overnight in LB-Chloramphenicol. Overnight cultures were miniprepped and checked by restriction enzyme digest using Eco-RI and Pst-I enzymes, transformants identified with the right size band (3.8 kB for ietAS) were checked by Sanger sequencing using VF2 and VR primers.

Cloning in the Multiclonal Site into pCAMBIA

To clone in our MCS into pCambia we digested pCambia with Sac-II and Sph-I which cut the plasmid at the edge of the plasmid backbone, removing the left and right border regions necessary for plant transformation. We separated and purified this digest by gel electrophoresis. Additionally, we digested our MCS IDT gBlock with Sac-II and Sph-I enzymes. We ligated the two fragments overnight and proceeded to transform them into chemically competent E. coli. Transformants were picked and grown overnight in LB-Kanamycin, and then mini prepped. The minipreps were checked by Sanger sequencing using custom primers. This new pCambia plasmid with inserted MCS was used by all other teams when cloning parts to be used in Agrobacterium.

Cloning ietAS into pCambia

To insert ietAS into pCambia we subcloned ietAS from pSB1C3. We digested pSB1C3 ietAS and pCambia MCS with Eco-RI and Spe-I enzymes. We separated and purified our digests using gel electrophoresis. Next, we proceeded to ligate the ietAS and pCambia digests together overnight. The overnight ligations were then transformed into chemically competent E. coli. Transformants were selected the following day and grown overnight in LB-Kanamycin. Cultures were then miniprepped and and digested, first with Eco-RI and Pst-I enzymes, then with Hind-III to check on a gel that the inserts were the correct size. The minipreps were then transformed into electrocompetent Agrobacterium the standard electroporation protocol (6) which can be found in Protocols.

Characterization of ietAS in Agrobacterium

To determine whether ietAS was effective at maintaining plasmids in Agrobacterium without antibiotic pressure we did a multiday plating assay. 3 biological replicates of both pCambia ietAS Agrobacterium and pCambia Agrobacterium were grown in 3 mL of LB overnight. Each day serial dilutions ranging from 10^-3 to 10^-8 were made from each replicate and spot plated on LB plates and LB-Kan plates. 3 uL of each culture was passaged into a fresh 3 mL of LB and grown to repeat the assay next day. On the first and last day, we also plated on LB-Gent and LB-Gent-Kan plates to see if ietAS contributed to the loss of the modified Ti plasmid present in Agrobacterium GV3101. Full details of this assay can be found in Protocols.

Figure 1 Cloning procedure for ietAS into pCambia and into pSB1C3.

Figure 2 pCambia ietAS digested with Hind-III, expected band sizes are 10kb(plasmid and segment ietAS) and 700kb(partial segment of ietA) as seen in the photo.

Figure 3 Plasmid stability plating assay, day 2. Top-left: pCambia without ietAS in Agrobacterium plated on LB-Kan agar. Bottom-left: pCambia without ietAS in Agrobacterium plated on LB agar. Top-right: pCambia with ietAS in Agrobacterium plated on LB-Kan agar. Bottom-right: pCambia with ietAS in Agrobacterium plated on LB agar. Each sample is plated as two technical replicates over five dilutions based on an OD 600 reading.

Figure 4 Effect of ietAS on plasmid stability. CFU ration is the number of CFU's on LB-Kan agar plate divided by the number of CFU's on LB agar plate. See protocols section for details. Each CFU value is the average of three biological replicates, each biological replicate had two technical replicates and was corrected against OD600 . Vertical bars represent standard deviation. On day 0 for ietAS there were too many colonies to count so we were unable to quantify that results for that day.

Results

Cloning

Cloning of ietA, ietS, and ietAS into pSB1C3 in E. coli was successful and confirmed by Sanger sequencing and restriction enzyme digest. Cloning the MCS into pCambia in E. coli was successful and confirmed by Sanger sequencing.

Subcloning ietAS into pCambia was attempted several times, with the last two times working. The ietAS pCambia cloning was confirmed using restriction enzyme digest with Eco-RI and Pst-1 as well as Hind-III(Figure 2) the resulting digests were run on a gel and the correct bands were observed. ietAS pCambia miniprep was successfully transformed into Agrobacterium.

Plasmid Stability

As cloning ietAS into pCambia delayed our progress for 3 weeks, we were unable to fully characterize the efficacy of ietAS on the plasmid stability. We ran a plasmid stability assay for 3 days using spot plating to compare the amount of colony forming units on LB versus LB-Kanamycin (Figure 3). Unexpectedly we noticed a decrease in the ratio of CFU's on LB-Kan to CFU's on LB with the ietAS (Figure 4).

Yamamoto et. Al saw at 15-fold decrease in colony forming units with the addition of ietAS with the plasmid containing the sacB gene conferring hypersensitivity to sucrose. In our plating experiment we did not see a significant difference between the pCambia plasmid containing ietAS and pCambia plasmid without ietAS. This could be due to the presence of pVS1 StaA on pCambia, a stabilizing protein which is shown to maintain plasmids containing it for 100 generations growing at 30℃ (Heeb et Al., 2000). In future work we could perform the same expirement knocking out the pVS1 staA gene in pCambia.

Conclusion

For our project we created a new composite Bio-Brick part that is shown in the literature to increase plasmid incompatibility with other repABC plasmids. This part is also shown in the literature to increases plasmid stability through toxin-antitoxin interaction. Having this part in our aGROW plasmid would add selective pressure to keep the plasmid in Agrobacterium despite the negative fitness of harboring CRISPR-Cas9. Further work on characterization of the ietAS construct can be done to quantify the added level of stability that ietAS adds to a plasmid, this can be used in conjunction with literature values. This is the first toxin-antitoxin part specifically for Agrobacterium that has been entered into the Biobrick registry of standard biological parts.

References

Heeb, S., Itoh, Y., Nishijyo, T., Schnider, U., Keel, C., Wade, J., Haas, D. (2000). Small, stable shuttle vectors based on the minimal pVS1 replicon for use in gram-negative, plant-associated bacteria. Molecular Plant-Microbe Interactions, 13(2), 232-237. doi:10.1094/MPMI.2000.13.2.232

Melderen, L. V., & Bast, M. S. (2009). Bacterial Toxin–Antitoxin Systems: More Than Selfish Entities? PLoS Genetics, 5(3). doi:10.1371/journal.pgen.1000437

Unterholzner, S. J., Poppenberger, B., & Rozhon, W. (2013). Toxin–antitoxin systems: Biology, identification, and application. Mobile Genetic Elements, 3(5), e26219. http://doi.org/10.4161/mge.26219

Yamamoto, S., Kiyokawa, K., Tanaka, K., Moriguchi, K., & Suzuki, K. (2009). Novel Toxin-Antitoxin System Composed of Serine Protease and AAA-ATPase Homologues Determines the High Level of Stability and Incompatibility of the Tumor-Inducing Plasmid pTiC58. Journal of Bacteriology, 191(14), 4656-4666. doi:10.1128/jb.00124-09