Team:British Columbia/Collaborations

University of Toronto Modeling Collaboration

The British_Columbia team collaborated with the University of Toronto iGEM team to test the CRISPR guide model our team developed. The University of Toronto desired to choose guides to target the AraC gene with CRISPR/dCas9 (catalytically inactive Cas9) in E.coli K12 MG1655 genome. Model execution determined their original guides sequences, AAACGAGTATCCCGGCAGCA and AACGAGTATCCCGGCAGCAG had a relatively low partition functions of 47.276 and 35.326 respectively, indicating that there would be many off target CRISPR/dCas9 matches on the genome. We provided their team the full list of guides sequences available for the AraC, ranked based on the partition function, and specified two guides that would be good choices for their project. Due to the use of CRISPR/dCas9, guides targeting near the beginning of the gene are desirable. The guides our model suggested were: TGGGCGTTAAACGAGTATCC, appearing on the bottom strand (with a PAM site at the 33rd nucleotide from the start), which has a partition function of 75.957; and TTAACGCCGATTGAGGCCAA appearing on the top strand (with a PAM site at the 86th nucleotide from the start), and has a partition function of 72.671. These guides should provide a more precise target for CRISPR/dCas9 while retaining the desired function of dCas9.

University of Calgary Newsletter Collaboration

This year, the University of Calgary’s iGEM team founded the first ever Canadian iGEM newsletter. Nine universities and two high schools from all across Canada became a part of this inaugural project, which shared the progress, challenges, and successes of the 2017 iGEM competition. The newsletter provides the opportunity to reach out for collaboration from fellow Canadian teams, and it led to our modelling collaboration with the University of Toronto. The Canadian iGEM Newsletter exemplifies iGEM’s promotion of inter-team and multidisciplinary collaboration, and we are honoured to have been a part of it.