Team:NU Kazakhstan/Design

Valet — A free HTML5 Template by FREEHTML5.CO

Whole construct assembly design

Initially 4 transcriptional units were ordered from IDT company using iGEM promotion. These 4 units were designed (additional flanking 24 bp sequences) in a such way so that it could be amplified using PCR and appropriate primers (Figure 1).

sequences

Figure 1. Ordered sequences from IDT

List of designed primers

  • Fwd AphVIII (Primer 1) CTGGATTGGATGTGCTGTTGACCG
  • Rev AphVIII (Primer 2) GACAGTGGCTAATGGCTGAAACGC
  • Fwd ChrR (Primer 3) CTGGCAGGTACGATGTATCCTCGG
  • Rev ChrR (Primer 4) TGTAGGGAACTGGGTACGCAATCC
  • Fwd Chromodulin (Primer 5) CGTCAGGACACTTGTTGACTTGGC
  • Rev Chromodulin (Primer 6) TTGACCTGGTACGAAGTAGCCTGC
  • Fwd Supernova (Primer 7) AGATCCTAGTTTGACCTGCGTGCC
  • Rev Supernova (Primer 8) ATTGCTGGGAATCCTACGAGTCCG

  • As it can be seen, these 4 transcriptional units have overlapping regions of the length of 49 bp each for Gibson Assembly (Figure 2).


    sequences

    Figure 2. Gibson Assembly in silico (SnapGene)

    Final construct looks like this (Figure 3):


    sequences

    Figure 3. Final construct (SnapGene)


    Design of primers for insertion into pChlamy_4 vector

    1. 100 µl of LUDOX and H2O should be added into A1, B1, C1, D1 and A2, B2, C2, D2 wells respectively
    2. The absorbance of all samples at 600nm should be measured absorbance in all standard measurement modes in instrument


    Protocol for Fluorescein Fluorescence Standard Curve

    1. Fluorescein stock tube was spinned down and pure pellet was
    2. 100 µM stock solution of fluorescein stock solution was prepared by resuspending fluorescein in 1 mL of 1xPBS
    3. 100 µM fluorescein stock solution was diluted with 1xPBS to make a 50 µM fluorescein solution
    4. 100 µl of PBS was added into wells A2, B2, C2, D2....A12, B12, C12, D12, while 200 µl​ of 50 µM fluorescein was added to A1, B1, C1, D1
    5. Serial dilution was be performed by adding 100 µl sample from previous to subsequent well for all the A, B, C and D rows
    6. Fluorescence of all samples was measured in all standard measurement modes in instrument using setup on figure 1.

    7. int1
      Figure 1. Fluorometric Measurement parameters


    Protocol for Cell Measurements

    Preparation of LB and LB plates with chloramphenicol

    1. Stock solution of 25 mg/mL chloramphenicol dissolved in 95% ethanol should be prepared
    2. In order to prepare LB medium, 25g LB broth powder and 1000mL of ultrapure water should be added into a 2L autoclaved bottle and mix the solution thoroughly
    3. In order to prepare LB agar, 25g LB broth powder, 1.5 gr of bacterial agar and 500 mL of ultrapure water should be added into 1L autoclaved bottle and mix the solution thoroughly
    4. The bottles should be loosely capped and autoclave tape should be placed
    5. Place both solutions should be autoclaved
    6. Once the solutions cooled down to the room temperature in the case of LB media and to about 50oC in the case of LB agar, add an appropriate amount of chloramphenicol stock solution so that the final chloramphenicol concentration of both solutions would be 25 µg/mL
    7. LB agar with chloramphenicol solution should immediately be poured into petri dishes before the solidification of the solution

    DNA resuspension

    1. Resuspend the DNA for each test device from Kit Pate 6 provided by IGEM 10 µL of nuclease free water
    2. Transfer the DNA solution into PCR tubes for convenience

    Preparing chemically of competent E.coli

    1. Beforehand 0.1M CaCl2 and 0.1M CaCl2 + 15% glycerol solutions were prepared
    2. 1 colony of DH5-alpha strain of E.coli was taken from LB plates and inoculated in 10mL of LB in 50 ml Falcon tube
    3. The tube with DH5-alpha E.coli strains in LB was placed into incubator at 37 oC, until OD600 reaches 0.2-0.3, shaking at 250 rpm
    4. Once the OD600 reaches 0.2-0.3, the tube with DH5-alpha strain was placed on ice for 15 min. Solutions of 0.1M CaCl2 and 0.1M CaCl2 + 15% glycerol kept in ice too
    5. Cells were centrifuged at 4 degrees Celsius for 10 min
    6. Pellet was resuspended with 3 ml of 0.1M CaCl2 and put on ice for 30 min
    7. Cells centrifuged again and re suspended in 300 µL of 0.1M CaCl2 + 15% glycerol
    8. 50 µL aliquots of resulting solution was prepared in separate Eppendorf tubes
    9. The aliquots were placed in Cold room at -80 degrees Celsius

    Chemical transformation of test devices and controls

    1. 8 tubes with 50µL of chemically competent cells were taken
    2. Each tube were appropriately labeled as follows: BBa_J364000, BBa_J364001, BBa_J364002, BBa_J364003, BBa_J364004, BBa_J364005, BBa_I20270 and BBa_R0040
    3. In each tube 1µL appropriate DNA from Kit Pate 6 sent by IGEM was added
    4. Cells were incubated on ice for 30 min
    5. Heat chock was performed in water bath at 42 degrees Celsius for 50 seconds
    6. Cells were incubated for 5 min on ice
    7. 950 µL of SOC media was added to all 8 tubes
    8. Cells were then placed into 15 ml falcon tubes and incubated at 37 degrees Celsius for 1 hours, shaking at 250 rpm
    9. 100µL of each transformation tubes was pipetted and spread with sterilized spreader onto petri dish with chloramphenicol present LB plates and incubated overnight at 37 degrees Celsius

    Inoculation

    1. 2 colonies was picked from each of 8 plates and inoculated on 5mL LB medium with Chloramphenicol
    2. The cells were grown overnight (16 hours) at 37 degrees Celsius and 220 rpm

    Measurements

    1. The OD600 of all samples was measured using Varioscan Flash plate reader (Thermo Sciencific)
    2. The cultures were diluted to a target OD600 of 0.02 according to dilution calculations and transferred to 50ml Falcon tubes completely covered with aluminum foil
    3. The cultures were incubated at 37 degrees Celsium and 220 rpm
    4. 500 µL samples of each of the 16 cultures should be taken at 0, 2, 4, and 6 hours of incubation and placed on ice
    5. At the end of the sampling point, 100 µL of each sample was pipetted into four vertical wells of 96-well plate. So that the cultures taken from the same plate were pipetted into the same column as shown in the Figure 2
    6. Set up the Fluorometric Measurement parameters as shown in Figure 1
    7. OD600 and Flurometric measurements was taken with Varioscan Flash plate reader (Thermo Sciencific)

    int2
    Figure 2. Placement of samples into 96 –well plate

    Results

    int3
    int4
    int5


    Conclusion

    According to the obtained data, the promoter of the second test device shows the highest fluorescence values. In addition, it has expected increase in fluorescence every two hours. The promoter with the weakest expression of fluorescence appears to be the test device 6, which has values slightly higher than the negative control. The fluorometric readings for the samples with promoters from devices 1,3, and 5 are moderate. If to look at general trends, the results demonstrate the boost in fluorescence after 4 hours of incubation.