Team:GZHS-United/Experiments

HOME
TEAM
• Team
• Attributions
• Collaborations
PROJECT
• Description
• Design
• Experiments
RESULTS
• Results
• Modeling
• Demonstrate
• Contribution
PARTS
• Parts
NOTEBOOK
• Notebook
• Gallery
• Timeline
• InterLab
SAFETY
• Safety
HUMAN PRACTICE
• Silver
• Gold & Integrated
• Public Engagement
• Entrepreneurship

Experiment

Principle

The goal of our project is to reduce the mosquito populations by toxins.

The two toxin proteins ,Mtx1 and Cry4Ba from B.s. and Bt.i respectively, are able to kill the mosquito larvae. The two proteins will be ingested with foods into the midintestine of the mosquito larvae and digested into some smaller fragments several of which can destroy the cells there. The intestine of the mosquito larvae will be seriously damaged during this process, which eventually causes the death of the mosquito larvae.

Method

Overall, in this project, we use the basic method of genetic engineering.

1. Acquisition of the objective genes :

In this project, two proteins(Mtx1 and Cry4Ba) are used to kill the mosquito larvae. There are two objective genes,the mtx1 and the Cry4Ba from the B.s. and the Bt.i respectively.First of all,the genomic DNA of the B.s and Bt.i was extracted by the method of the “TIANGEN TIANamp Bacteria DNA Kit” and the PCR method was used to amplify the two genes (Mtx1 and Cry4Ba) respectively.The basic PCR was used to amplify of the gene Cry4Ba, and the “Nested PCR” was used to amplify the other gene Mtx1 due to the non-specific fragments we observed during the PCR experiments.

Mtx1 gene (2613 bp)was amplified using primer set, F-mtx-T1 (ATGGCTATAAAAAAAGTATTAAAAATA) and R-mtx-T1 (TTATCTGGGTTCTACACCTGGTGAA). Nested PCR use two pair of primers to improve specificity of Mtx1 gene( not show in this page).Cry4Ba gene (3411 bp) was amplified using primer set, F-cry4Ba-T1 (ATGAATTCAGGCTATCCGTTAGCGAAT) and R-cry4Ba-T1 (TTACTCGTTCATGCAAATTAATTCAATGC), designed by advisor.

PCR amplification of this two gene were performed as described by the manufacturer (Takara, China)

Run the PCR using the following program:

1. 72°C for 3 minutes
2. 98°C for 30 seconds
3. 5 cycles of:
   • 98°C for 10 seconds
   • 60°C for 30 seconds
   • 72°C for 3 minutes
4. Hold at 16°C

2、Construction of Mtx1 and Cry4Ba cloning plasmid and transform the plasmid into E.coli DH5a.

PCR products were pooled from triplicates and cloned using pEASY-T1 Simple Cloning Kit (TransGen Biotech, Beijing) and sequenced by TIANYI HUIYUAN (Guangzhou,China).

Ligation reaction Protocol

1. Combine the pEASY-T1 DNA and the DNA insert in a total volume of 5μl.
   The recommended vector : insert ratio is 25 fmol vector : 25 – 250
   fmol insert. (Note : 25 fmol of pUC118 DNA (3,162 bp) corresponds to approx. 50 ng).
2. Add one volume of Ligation Mix (1-5ul) to the DNA solution and mix thoroughly.
3. Incubate at 25˚C for 20 minutes.
4. The ligation reaction mixture can be used directly for transformation of E. coli competent cells.

Transformation Protocol

1. Thaw Competent Cells in an ice bath just before use.
2. Add no more than 10 ng of DNA for transformation.
3. Place tubes on ice for 30 min.
4. Heat shock the cells for exactly 45 sec at 42°C.
5. Place tubes on ice for 1–2 min.
6. Add SOC medium to bring the final volume to 1 ml. SOC medium should be warmed to 37°C before using.
7. Incubate by shaking (160–225 rpm) for 1 hr at 37°C.
8. Plate an appropriate amount of culture on selective medium for plasmids that permit blue/white screening of transformants.
9. Incubate overnight at 37°C

3、Colony screening for positive transformants

Colony PCR was used to determine insert orientation. PCR amplification of the plasmid using an insert specific primer paired with a vector specific primer can be designed to produce an amplicon of a specific size only if the insert is in the correct orientation.

4. Construction of standard plasmid

5. Construction of Mtx1 and Cry4Ba expression plasmid

PCR products were pooled from triplicates and cloned using pEASY-Blunt E1 Expression Kit (TransGen Biotech, Beijing) and sequenced by TIANYI HUIYUAN (Guangzhou,China).

After constructing expression vector, we will transform the plasmid into E.coli BL21.

6. Testing for Recombinant Protein Expression in E. coli

The expression of cloned genes under the control of the lac operon is induced by IPTG.

1. Inoculate ~10 colonies into a 14-mL tube containing 5 mL of liquid LB and the appropriate antibiotics.
2. Grow cells for a few hr at 37 ºC, shaking at 250-300 rpm. Make sure the tubes are tilted.
3. Watch the turbidity. Once the culture reaches an OD at 600 nm (OD600) of 0.4-0.6 (takes 2-4 hr, depending on the sample), take out 2 mL of the culture. Measure the actual OD600. Aliquot the equivalent of 1 mL of cells at OD600 = 0.8 in a 1.5-mL microfuge tube, i.e., volume in mL = 0.8/OD600 of sample. Spin down at maximum speed for at least 1 min. Carefully remove all of the supernatant with a vacuum line. This is your uninduced sample. Store the cells at -20 ºC.
4. Add 3 µL of 1 M IPTG to the remaining culture. Continue shaking at 300 rpm overnight but at a lower temperature of 23 ºC.
5. The next day, measure the OD600. Spin down two tubes containing the equivalent of 1mL of cells at OD600 = 0.8 and remove the supernatant. These are your induced samples — one tube will be used to test for expression and the second for solubility. Store the cells at -20 ºC.

7. Purification of His-tagged Proteins

1. Remove the Ni + NTA filler from 4 °C and mix with ethanol and install the column.
2. Use 10 column volume of H₂O column, wash away the ethanol.
3. Use 50mL binging buffer over the column.
4. Protein solution at 4 ℃, 12000rpm centrifugation 10min, take the supernatant, with bingding buffer diluted to 5 times.
5. Protein dilution column, may be appropriate to reduce the column rate, so that the protein and the column fully integrated.
6. To 50mL washing buffer over the column.
7. With 20mL elution buffer column, with Eppendorf tube took the column solution, each measured A280 value, compared with the measured A280 before the value of the comparison.
8. Each tube SDS-PAGE identification of protein abundance.

After that, you can get the Mtx protein and Cry4Ba protein solution for the back of the mosquito larvae toxicology experimental part of the preparation.

8. Toxicity Test

To demonstrate the toxicity of our Engineered E.coli, we did two toxicity tests based on different variables. Our test system include 50mL ddH2O and 20 2nd instar Aedesalbopictus larvae. The bacterial was mixed with 0.2 g cat food and embedded by 100uL agarose to form gel-like “bait”.

1. Variable：Concentration of Cry4Ba E.coli
   Test the toxicity of five different concentrations(1%,2%,3%,4%,5%), each concentration has three repetitions. Calculate the death rate in eight time points(2h, 4h, 6h, 8h, 10h, 12h, 24h, 48h).
2. Variable：Kinds of toxin
   Test the toxicity of three toxins (Bt.i, Bs, ry4Ba E.coli, BL21 E.coli) and one control group (replace bacterial by water), each group duplicated for three times. Both toxins and water are equal to concentration of 5% in the whole system.