Team:Kent/Parts

Parts

Basic Parts

BBa_K2340000

Our dCas13a - GFP construct was synthesized by Integrated DNA Technologies. The dCas13a gene sequence was obtained from addgene (http://www.addgene.org/83485/). There are three forbidden restriction sites in the sequence and they were swapped out using a codon usage table. The sequence of the GFP with the standard 25 prefix/suffix (BBa_K648013) was taken from the biobrick library. GFP was chosen as a reporter as it is a frequently used reporter. To improve the stability and activity and conserving the characteristics of the separate proteins we added a flexible linker sequence to separate the two protein domains (DNA sequence: ggctcctccggc. Amino acid sequence: GSSG). To improve imaging, the dCas13a - GFP construct was sequesteredTo reduce background noise, unbound dCas13a - GFP should be stored in the nucleus. This allows the assumption that any dCas13a moving out the nucleus is tracking its target mRNA. To ensure that unbound dCas13a moves from the cytosol (where it’s translated) to the nucleus, nuclear localization sequences (NLS, DNA sequence: cccaagaaaaaacgcaaggtg, amino acid sequence: PKKKRKV) were added on the N-terminal and the C-terminal of the protein.

BBa_K2340001

Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is GAAAGCAATGCTATCACCTC. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints.

BBa_K2340002

Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is TTTGGGGGATGCTCGCTCCA. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints

BBa_K2340003

Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is GAAAGCAATGCTATCACCTC. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints

BBa_K2340004

RAB13 guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to RAB13 is AAGTGTTGTTGAAGTTGTCC. This is one of RAB13 guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints

BBa_K2340005

Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is CTCCTTGATGCTTTTCATCC. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints

BBa_K2340006

Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is AGTAACAGAATAAATCAGTG. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints

BBa_K2340007

Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is TCTGTGCATCCGTCAGGGTC. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints

BBa_K2340008

Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is ACATTTCCTCACTTCCCTGA. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints

BBa_K2340009

Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is ACCCAAATTCCCAAAATGTC. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints

BBa_K2340010

Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is CCACCCCAGCAGCACCCTCA. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints

BBa_K2340011

Human ꞵ-actin guide RNA construct with a human U6 promoter and human U6 terminator. This product will be translated by RNA polymerase III to form a guide RNA. This small RNA strand can be processed by the CRISPR dCas13a from Leptotrichia buccalis (LbuC2c2; BBa_K2340000) to form a CRISPR RNA (crRNA). The sequence that is complementary to Human ꞵ-actin is TCAAAAGAGGAAGGTGAATG. This is one of Human ꞵ-actin guide RNA constructs we have constructed DNA for this part has not been submitted as a sample to the registry due to time restraints