Gibson Assembly allows for successful assembly of multiple DNA fragments, regardless of fragment length or end compatibility. (1). The method was invented in 2009 by Daniel G. Gibson, of the J. Craig Venter Institute. The assembly reaction is carried out in one single reaction-tube, all at once, at 50° Celsius for 15-60 minutes. The process involves three different enzymatic actions. A 5’ exonuclease creates overhangs, enabling matched fragments to anneal. Then a DNA polymerase fills gap between the annealed strands and the 5´ end. Finally, a DNA ligase seals the gaps between the filled in gap and the annealed strands.

Protocol used for Gibson

Modifications
(Used for insertion of nmt1, cyc1, sfGFP and composite part into submition vector pSB1C3 and insertion of composite part into yeast vector) (i) Volume Changes:
    V_insert = x
    V_vector = y
    V_gibson = x+y
    V_water = 0µl

(ii) Incubation for 1h, not 15 min
(iii) Before transformation: One transformation with x ul concentrated Gibson solution and one transformation with Gibson solution diluted 1:3 and transformation with 3*x ul diluted Gibson solution.

E.coli TOP10 (Used for nmt1, cyc1, sfGFP and composite part) : One Shot® TOP10 E. coli are provided at a transformation efficiency of 1 x 109 cfu/µg supercoiled DNA and are ideal for high-efficiency cloning and plasmid propagation. They allow stable replication of high-copy number plasmids.

Chemical Transformation Procedure

Modifications
In Step 5, Incubate for exactly 30-45 seconds in the 42°C water bath. Do not mix or shake. In Step 7, Add 200-250 µl of rom temperatured S.O.C medium to each vial. S.O.C is a rich medium; sterile technique must be practiced to avoid contamination

E.coli DH5Alpha (Used for the Interlab and for purification of sfGFP):
Protocol Modifications:
Step 15 and Step 16 not done

The goal of PCR is to amplify a section of DNA of interest for DNA analysis (e.g. gene insertion, sequencing, etc). The amplification rate is exponential.

• Tag polimerase (25µl reaction) Used for colony PCR for cyc1
Protocol Here
Specifications


10X Standard Taq Reaction Buffer	2.5 μl
10 mM dNTPs	0.5 µl
10 µM VF2	0.5 µl
10 µM VR	0.5 µl
Template DNA	variable
Taq DNA Polymerase	0.125 µl
Nuclease-free water to	25 µl

1) 95°C	30 sec
2) 95°C	30 sec
3) 63°C	1 min
4) 68°C	1 min/kb
5) 2/30X
6) 68°C	5 min
7) 10°C	forever




• Phusion polymerase (20µl reaction) Used for colony PCR for nmt1 and composite part :
Protocol Here
Specifications


15X Phusion HF or GC Buffer	4 µl
10 mM dNTPs	0.4 µl
10 µM VF2	1 µl
10 µM VR	1 µl
Template DNA	variable
Phusion DNA Polymerase	0.2 µl
Nuclease-free water to	20 µl

1) 95°C	30 sec
2) 98°C	30 sec
3) 63°C	1 min
4) 72°C	1 min/kb
5) 2/30X
6) 72°C	5 min
7) 10°C	forever




• 5 PRIME HotMasterMix (50µl and 10µl reaction) Used for colony PCR for nmt1 and composite part :
Protocol Here
Specifications


10 µM VF2	0.4 µl
10 µM VR	0.4 µl
Template DNA	variable
Phusion DNA Polymerase	4 µl
Nuclease-free water to	10 µl

1) 92°C	2 min
2) 94°C	20 sec
3) 55°C	30 sec
4) 70°C	1 min/kb
5) 2/30X
6) 70°C	5 min
7) 10°C	forever


Primers for amplification of composite part:
Fw: aaaaagaattcgcggccgcttc
Rev: aaaaactgagcggccgctactag

For making a small 1% gel:

Weigh out 0.5 g of agarose and mix it with 50 ml of 1x TAE buffer in a 100 ml Erlenmeyer flask.

Dissolve the agarose by bringing the mixture to the boiling point in a microwave oven, followed by mixing (by swirling the flask). Repeat the heating and mixing until all the agarose has dissolved.

Cool the agarose solution to ~50 o C by leaving it on the bench for ~20 min (or you may accelerate the cooling by applying cold water from the tap to the outside of the flask).

Using gloves, add 5 l GelRed (10 000x). Swirl the flask gently to mix, try to avoid bubbles.

Pour the gel carefully into the mold. Bubbles may be removed/punctured by using a pipette tip.

Protocol
Modifications:

During the first attempt ethanol was not added to the PE buffer, which resulted in an unsuccessful miniprepl

In the second attempt 72/4% ethanol was added, as opposed to the recommended 96-100%, resulting in a successful miniprep

Protocol
Load cells into Cell:

1. Attach flow valve to big straight hole. Look at the nylon ball at he end and make sure it’s not distorted and misshapen. Make sure valve is closed. Attach dispenser + small tubing to the other hole (small and slanted).
2. Examine the piston to make sure the o-rings are not nicked or distorted. Push piston into cell to line.
3. Remove cap on other end.
4. Pour sample into cell. Fill completely (1 mL for small cell).
5. Put cap on the end. Firmly push the cap down – the best way is to use the heel of your hand and hit the cap hard until it’s completely seated.
6. Turn setup over. Put in Press with piston up.
7. Mini cell can be loaded in your hand, but the large cell is too heavy to load this way. There is a black 3 columned stand next to the Press (may be pushed back on the counter). Put the large cell upside down (piston down). Fill the cell the same way as the mini cell.

Run:

1. Turn the Ratio Selector to Down position and turn the Pressure Increase control fully counterclockwise. The press needs to go down enough for the cell and extended piston.
2. Pump on.
3. Pressure Increase clockwise to 800 (turn knob) for mini-cell and 1000 for large cell.
4. Pump off.
5. For mini-cell turn Ratio Selector to medium.
6. Put cell on the stand – make sure you can turn the flow valve on the cell, that it’s not blocked by anything. Make sure the cell is aligned properly so that the piston squarely strikes under the upper platen. Make sure the piston handles are perpendicular to the bar and it’s screws (if it’s not, as the piston is pushed down the handles will run into the screws and something will break). Swing the bar across the cell and make sure it is completely against the cell. If it’s not, the cell could pop off the stand when pressure is applied. If the screws on the bar get in the way – unscrew them enough to slide over cell and then tighten them).
7. Pump on.
8. When the pressure gets to 800, slowly release cells by tapping (not hitting) the flow valve (black handle) with a pen – cells must come out slowly, drop by drop (pump on still), 15 drops/min. Several labs feel that tapping with a pen gives a more consistent and reproducible release of the cells. The drop rate tends to increase near the end of the run. As you approach the end of the run, you may want to close the flow valve slightly by turning it clockwise before opening it again. Also, there might be air bubbles in the sample and these tend to squirt into the collection tube and if you aren’t careful where you hold your collection tube, you could lose your sample. Be very careful that the tubing is in your collection tube and not pointing towards your face.
9. Pump off.
10. Turn the Ratio Selector down.
11. If you are done for the day, turn the Pressure Increase control fully counterclockwise.
12. Pump on.
13. Wash cell with H₂O.

Growth protocol: yeast with GFP strain 680 (nmt1-GFP-ppk18)

1. Wake the cells by plating them and incubate on 32 Celsius for 48 hours
-the yeast cells are stored and hibernating at -80 celcius
2. Make a liquid culture with thiamine to supress the expression of GFP and let the cells further incubate on 25 Celsius for 24 hours on shaker.
- 50 mL EMM
- 25 uL thimamine
3. Measure OD of the culture and check for contamination under a microscope.
-dilute the culture morning and night with more medium to make sure the cells don't starve.
4. Spinn the culture to extract the thiamine from the solution, make a new liquid culture and incubate on 25 Celsius for another 24 hours on shaker.
-this will induce the expression of GFP
5. Measure OD of the culture and check for contamination again.
-dilute the culture to be at around 0.05 OD as this gives the best results with the laser.

96-Well Transformation Protocol:
Protocol
Plate reader protocol:
Protocol