Line 1: | Line 1: | ||
{{SECA_NZ}} | {{SECA_NZ}} | ||
<html> | <html> | ||
+ | <div class="spacer"></div> | ||
<div class='container'> | <div class='container'> | ||
<div class='row'> | <div class='row'> | ||
Line 6: | Line 7: | ||
<h1>Our <mark class="green-mark">Part</mark></h1> | <h1>Our <mark class="green-mark">Part</mark></h1> | ||
</div> | </div> | ||
+ | <div class="spacer"></div> | ||
</div> | </div> | ||
<div class='row'> | <div class='row'> | ||
Line 13: | Line 15: | ||
</h3> | </h3> | ||
</div> | </div> | ||
+ | <div class="spacer"></div> | ||
</div> | </div> | ||
<div class="spacer"></div> | <div class="spacer"></div> | ||
Line 58: | Line 61: | ||
</div> | </div> | ||
+ | <div class="spacer"></div> | ||
</html> | </html> |
Latest revision as of 02:58, 31 October 2017
Our Part
The part we submitted to the BioBrick Registry
BBa_K2291001
The Ice Inhibitor
Sequence - 669bp
atggcgaactgctgtctcttattattgtttctggcccttttgctacctgcggcatctgctacgagttgccatccggatgatcttcacgcccttagagggttcgccggaaacctctctgggggaggagtgctgcttagaagtgtgtggagtggcgattcatgttgcggctgggaaggagtaggatgcgacgacgcttccggaagggtgaccacaatgtggctcccccgaagagggctcgtcaaacccgtaccaggcgcctccctcgctggcgtcacagaattggaggaactcataacgaggaacagacgagccttggaagaacagcctaacaccatacaaggtacgaataacaatgtcagggacgggtgttacaacgctttgtccggcaacgataatacggttataagcggcaataataacactgtatcaggatcttttaatacgatcgtgaccggatgtcataatactgtatcagggtctaatcaggttgtcagtggtctgaaccacattgtgaccgatgataataatgatgttagtggcaacgataataacgtatcaggttcattccacacggtctccggcagtcacaacaccgtcagcggatcaaataatacggttagcggcaggaatcacgtagtaaccggtagcaataaagtagttactggtgga
Origin and Purpose
This part comes from the DaIRIP4 protein from Antarctic Hairgrass, Deschampsia antarctica.
This protein is an ice recrystallisation inhibition protein designed to stop ice crystals from growing and breaking cell membranes.
Characterisation
Initial testing shows that the DaIRIP4 protein is effective in the model plant chassis, Arabidopsis thaliana. It is currently unclear how effective this part would be in other organisms. Further characterisation of the part using the BioBrick system would be valuable.
Further information on this part can be found in the BioBrick Registry