Team:UiOslo Norway/Lab


Protocols

  1. Gibson

    2. Gibson Assembly allows for successful assembly of multiple DNA fragments, regardless of fragment length or end compatibility. (1). The method was invented in 2009 by Daniel G. Gibson, of the J. Craig Venter Institute. The assembly reaction is carried out in one single reaction-tube, all at once, at 50° Celsius for 15-60 minutes. The process involves three different enzymatic actions. A 5’ exonuclease creates overhangs, enabling matched fragments to anneal. Then a DNA polymerase fills gap between the annealed strands and the 5´ end. Finally, a DNA ligase seals the gaps between the filled in gap and the annealed strands.

    Protocol used for Gibson

    Modifications
    (Used for insertion of nmt1, cyc1, sfGFP and composite part into submition vector pSB1C3 and insertion of composite part into yeast vector) (i) Volume Changes:
        Vinsert = x
        Vvector = y
        Vgibson = x+y
        Vwater = 0µl

    (ii) Incubation for 1h, not 15 min
    (iii) Before transformation: One transformation with x ul concentrated Gibson solution and one transformation with Gibson solution diluted 1:3 and transformation with 3*x ul diluted Gibson solution.


  2. Transformation

    3. E.coli TOP10 (Used for nmt1, cyc1, sfGFP and composite part) : One Shot® TOP10 E. coli are provided at a transformation efficiency of 1 x 109 cfu/µg supercoiled DNA and are ideal for high-efficiency cloning and plasmid propagation. They allow stable replication of high-copy number plasmids.

    Chemical Transformation Procedure

    Modifications
    In Step 5, Incubate for exactly 30-45 seconds in the 42°C water bath. Do not mix or shake. In Step 7, Add 200-250 µl of rom temperatured S.O.C medium to each vial. S.O.C is a rich medium; sterile technique must be practiced to avoid contamination

    E.coli DH5Alpha (Used for the Interlab and for purification of sfGFP):
    Protocol Modifications:
    Step 15 and Step 16 not done


  3. PCR

    4. The goal of PCR is to amplify a section of DNA of interest for DNA analysis (e.g. gene insertion, sequencing, etc). The amplification rate is exponential.
    • Tag polimerase (25µl reaction) Used for colony PCR for cyc1
      • Protocol Here Specifications
      10X Standard Taq Reaction Buffer 2.5 μl 10 mM dNTPs 0.5 µl 10 µM VF2 0.5 µl 10 µM VR 0.5 µl Template DNA variable Taq DNA Polymerase 0.125 µl Nuclease-free water to 25 µl Cycles: 1) 95°C 30 seconds 2) 95°C 30 seconds 3) 63°C 60 seconds 4) 68°C 1 min/kb 5) 2/30X 6) 68°C 5 min 7) 10°C forever

    • Phusion polymerase (20µl reaction) Used for colony PCR for nmt1 and composite part :
      • Protocol Here Specifications
      15X Phusion HF or GC Buffer 4 µl 10 mM dNTPs 0.4 µl 10 µM VF2 1 µl 10 µM VR 1 µl Template DNA variable Taq DNA Polymerase 0.2 µl Nuclease-free water to 20 µl Cycles: 1) 95°C 30 seconds 2) 98°C 30 seconds 3) 63°C 60 seconds 4) 72°C 1 min/kb 5) 2/30X 6) 72°C 5 min 7) 10°C forever

    • 5 PRIME HotMasterMix (50µl and 10µl reaction) Used for colony PCR for nmt1 and composite part :
      • Protocol Here Specifications
      10 µM VF2 0.4 µl 10 µM VR 0.4 µl Template DNA variable 5 PRIME HotMasterMix 4 µl Nuclease-free water 5.2 µl Cycles: 1) 94°C 2 min 2) 94°C 20 seconds 3) 55°C 30 seconds 4) 70°C 1 min/kb 5) 2/30X 6) 70°C 5 min 7) 10°C forever Primers for amplification of composite part: Fw: aaaaagaattcgcggccgcttc Rev: aaaaactgagcggccgctactag


  4. Gel

    5. For making a small 1% gel:
      Weigh out 0.5 g of agarose and mix it with 50 ml of 1x TAE buffer in a 100 ml Erlenmeyer flask.
      Dissolve the agarose by bringing the mixture to the boiling point in a microwave oven, followed by mixing (by swirling the flask). Repeat the heating and mixing until all the agarose has dissolved.
      Cool the agarose solution to ~50 o C by leaving it on the bench for ~20 min (or you may accelerate the cooling by applying cold water from the tap to the outside of the flask).
      Using gloves, add 5 l GelRed (10 000x). Swirl the flask gently to mix, try to avoid bubbles.
      Pour the gel carefully into the mold. Bubbles may be removed/punctured by using a pipette tip.

  5. Miniprep


    6. Protocol
    Modifications:
      During the first attempt ethanol was not added to the PE buffer, which resulted in an unsuccessful miniprepl
      In the second attempt 72/4% ethanol was added, as opposed to the recommended 96-100%, resulting in a successful miniprep

  6. INTERLAB

    7. 96-Well Transformation Protocol:
    Protocol
    Plate reader protocol:
    Protocol

References:

[1] Gibson

Problemveien 7, Oslo, Norway

uioslonorway@gmail.com