Difference between revisions of "Team:Lethbridge/Experiments"
Keithaiken (Talk | contribs) |
Kristiturton (Talk | contribs) |
||
| Line 80: | Line 80: | ||
<tr> | <tr> | ||
<td><a href="https://static.igem.org/mediawiki/2017/d/df/PhenolChloroform_extraction_%26_ethanol_percipitation.pdf" target="_blank">Phenol/Chloroform Extraction and Ethanol Precipitation</a></td> | <td><a href="https://static.igem.org/mediawiki/2017/d/df/PhenolChloroform_extraction_%26_ethanol_percipitation.pdf" target="_blank">Phenol/Chloroform Extraction and Ethanol Precipitation</a></td> | ||
| − | <td><a href="https://static.igem.org/mediawiki/2017/e/eb/PJET_Cloning.pdf">pJET Cloning</a></td> | + | <td><a href="https://static.igem.org/mediawiki/2017/e/eb/PJET_Cloning.pdf" target="_blank">pJET Cloning</a></td> |
</tr> | </tr> | ||
| − | <tr | + | <tr> |
| − | <td><a href="https://static.igem.org/mediawiki/2017/0/08/Plasmid_Miniprep.pdf">Plasmid Miniprep</a></td> | + | <td><a href="https://static.igem.org/mediawiki/2017/0/08/Plasmid_Miniprep.pdf" target="_blank">Plasmid Miniprep</a></td> |
| − | <td><a href="https://static.igem.org/mediawiki/2017/7/78/Preparation_of_Chemical_Competent_Cells.pdf">Preparation of Chemical Competent Cells</a></td> | + | <td><a href="https://static.igem.org/mediawiki/2017/7/78/Preparation_of_Chemical_Competent_Cells.pdf" target="_blank">Preparation of Chemical Competent Cells</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td><a href="https://static.igem.org/mediawiki/2017/2/2c/Protein_Overexpression_.pdf">Protein Overexpression</a></td> | + | <td><a href="https://static.igem.org/mediawiki/2017/2/2c/Protein_Overexpression_.pdf" target="_blank">Protein Overexpression</a></td> |
<td><a href="https://static.igem.org/mediawiki/2017/5/5f/PURExpress.pdf">PURExpress NEB Kit</a></td> | <td><a href="https://static.igem.org/mediawiki/2017/5/5f/PURExpress.pdf">PURExpress NEB Kit</a></td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td><a href="https://static.igem.org/mediawiki/2017/f/fc/Purification_of_Poly-Histidine_Tagged_Proteins.pdf">Purification of Poly-Histidine Tagged Proteins</a></td> | + | <td><a href="https://static.igem.org/mediawiki/2017/f/fc/Purification_of_Poly-Histidine_Tagged_Proteins.pdf" target="_blank">Purification of Poly-Histidine Tagged Proteins</a></td> |
| − | <td><a href="https://static.igem.org/mediawiki/2017/1/10/Restriction_Enzyme_Digest_and_Dephosphorylation.pdf">Restriction Enzyme Digest and Dephosphorylation</a></td> | + | <td><a href="https://static.igem.org/mediawiki/2017/1/10/Restriction_Enzyme_Digest_and_Dephosphorylation.pdf" target="_blank">Restriction Enzyme Digest and Dephosphorylation</a></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td><a href="https://static.igem.org/mediawiki/2017/2/2a/T7-RNA_Polymerase_Purification.pdf">T7- RNA Polymerase Purification</a></td> | + | <td><a href="https://static.igem.org/mediawiki/2017/2/2a/T7-RNA_Polymerase_Purification.pdf" target="_blank">T7- RNA Polymerase Purification</a></td> |
<td><a href="https://static.igem.org/mediawiki/2017/a/a6/Transformation.pdf">Transformation</a></td> | <td><a href="https://static.igem.org/mediawiki/2017/a/a6/Transformation.pdf">Transformation</a></td> | ||
</tr> | </tr> | ||
Revision as of 23:03, 28 October 2017
Protocols
Products/Reagents
| Enzymes | Buffers/Reagents | Other Products |
|---|---|---|
| Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
| DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
| Phusion Polymerase Master Mix | Kanomycin / Chloramphenicol / Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
| PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
| T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
| T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | Dialyzation Membrane |
| PURExpressKit (New England Biolabs) | Phenol | |
| XbaI (NEB) | Chloroform | |
| SpeI (NEB) | 10x PFU Buffer | |
| PstI (NEB) | NTP | |
| EcoRI (NEB) | GMP | |
| Dream Taq DNA Polymerase | 10x Taq Buffer | |
| Taq DNA Polymerase | Ligase Buffer | |
| RNAse A | SDS-PAGE Reagents | |
| TraB | Urea PAGE reagents | |
| iPPase | Agarose | |
| RNAse Inhibitor | Agar | |
| DNAseI | Tryptone | |
| Yeast Extract | ||
| TAKMz | BioBasic Plasmid DNA miniprep Kit | |
| Imidazole |
