Kristiturton (Talk | contribs) |
Kristiturton (Talk | contribs) |
||
Line 18: | Line 18: | ||
<body> | <body> | ||
<div><img src="https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png" class="center fit"></div> | <div><img src="https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png" class="center fit"></div> | ||
+ | <style> | ||
+ | a:link { | ||
+ | color: Blue; | ||
+ | background-color: transparent; | ||
+ | text-decoration: none; | ||
+ | } | ||
+ | |||
+ | a:visited { | ||
+ | color: red; | ||
+ | background-color: transparent; | ||
+ | text-decoration: none; | ||
+ | } | ||
+ | |||
+ | a:hover { | ||
+ | color: red; | ||
+ | background-color: transparent; | ||
+ | text-decoration: underline; | ||
+ | } | ||
+ | |||
+ | a:active { | ||
+ | color: yellow; | ||
+ | background-color: transparent; | ||
+ | text-decoration: underline; | ||
+ | } | ||
+ | </style> | ||
<p><a href=protocol">LB Media</a></p> | <p><a href=protocol">LB Media</a></p> |
Revision as of 20:20, 27 October 2017
DNA PUrification from Enzymatic Reactions
Phenol/Chloroform Extraction and Ethanol Precipitation
Preparation of Chemical Competent Cells
Purification of Poly-Histidine Tagged Proteins
Restriction Enzyme Digest and Dephosphorylation
T7- RNA Polymerase Purification
table { font-family: arial, sans-serif; border-collapse: collapse; width: 100%; } td, th { border: 1px solid black; text-align: left; padding: 8px; } tr:nth-child(even) { background-color: white; }Enzymes | Buffers/Reagents | Other Products |
---|---|---|
Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
Phusion Polymerase Master Mix | Kanomycin/Chloramphenicol/Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | |
PURExpressKit (New England Biolabs) | Phenol | |
XbaI (NEB) | Chloroform | |
SpeI (NEB) | 10x PFU Buffer | |
PstI (NEB) | NTP | |
EcoRI (NEB) | GMP | |
Dream Taq DNA Polymerase | 10x Taq Buffer | |
Taq DNA Polymerase | Ligase Buffer | |
RNAse A | SDS-PAGE Reagents | |
TraB | Urea PAGE reagents | |
iPPase | Agarose | |
RNAse Inhibitor | Agar | |
Tryptone | ||
Yeast Extract | ||
BioBasic Plasmid DNA miniprep Kit |