Kristiturton (Talk | contribs) |
Kristiturton (Talk | contribs) |
||
Line 13: | Line 13: | ||
/*VISIBLE CONTENT STYLING BEGINS HERE*/ | /*VISIBLE CONTENT STYLING BEGINS HERE*/ | ||
− | body {padding-top: 3.89em; background-color:#F2F2F2; color: black !important;} | + | body {padding-top: 3.89em; font-family: Arial, sans-serif; background-color:#F2F2F2; color: black !important;} |
+ | h1, h2 {text-align: center; color: black !important} | ||
+ | h3 {font-style: oblique;} | ||
+ | .userWrapper {margin-left: 7%; margin-right: 7%;} | ||
+ | .segmentHeader {font-size: 4vw; overflow: hidden; text-align: center;} | ||
+ | .segmentHeader:before, .segmentHeader:after {background-color: black; content: ""; display: inline-block; height: 3px; position: relative; vertical-align: middle; width: 50%;} | ||
+ | .segmentHeader:before {margin-left: -50%; right- 0.5 em;} | ||
+ | .segmentHeader:after {left: 0.5em; margin-right: -50%;} | ||
+ | .segmentDiv {margin-left: 5% !important; margin-right: 5% !important;} | ||
+ | .pageText {font-size: calc(12px + 0.5vw) !important; line-height: calc(1.1em + 0.5vw) !important; text-align: left !important; width:99%; padding: 20px; font-weight: normal;} | ||
+ | |||
+ | .segmentContainer p.segment2 {font-size: calc(22px + 0.5vw) !important; line-height: calc(1.1em + 0.5vw) !important;} | ||
+ | .contentDiv {display: inline-block; vertical-align: middle;} | ||
</style> | </style> | ||
</head> | </head> | ||
<body> | <body> | ||
<div><img src="https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png" class="center fit"></div> | <div><img src="https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png" class="center fit"></div> | ||
+ | |||
+ | <br><br><br><br> | ||
+ | |||
+ | <div class="segmentDiv"> | ||
+ | <div class="centerContainer"> | ||
+ | <h2 class="segmentHeader">Protocols</h2> | ||
+ | |||
+ | |||
<style> | <style> | ||
a:link { | a:link { | ||
Line 80: | Line 100: | ||
<p><a href=protocol">Transformation</a></p> | <p><a href=protocol">Transformation</a></p> | ||
+ | <br><br><br><br> | ||
− | + | <div class="segmentDiv"> | |
− | + | <div class="centerContainer"> | |
− | + | <h2 class="segmentHeader">Products/Reagents</h2> | |
− | + | ||
− | + | ||
td, th { | td, th { |
Revision as of 20:32, 27 October 2017
![](https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png)
Protocols
DNA PUrification from Enzymatic Reactions
Phenol/Chloroform Extraction and Ethanol Precipitation
Preparation of Chemical Competent Cells
Purification of Poly-Histidine Tagged Proteins
Restriction Enzyme Digest and Dephosphorylation
T7- RNA Polymerase Purification
Products/Reagents
td, th { border: 1px solid black; text-align: left; padding: 8px; } tr:nth-child(even) { background-color: white; }Enzymes | Buffers/Reagents | Other Products |
---|---|---|
Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
Phusion Polymerase Master Mix | Kanomycin/Chloramphenicol/Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | |
PURExpressKit (New England Biolabs) | Phenol | |
XbaI (NEB) | Chloroform | |
SpeI (NEB) | 10x PFU Buffer | |
PstI (NEB) | NTP | |
EcoRI (NEB) | GMP | |
Dream Taq DNA Polymerase | 10x Taq Buffer | |
Taq DNA Polymerase | Ligase Buffer | |
RNAse A | SDS-PAGE Reagents | |
TraB | Urea PAGE reagents | |
iPPase | Agarose | |
RNAse Inhibitor | Agar | |
Tryptone | ||
Yeast Extract | ||
BioBasic Plasmid DNA miniprep Kit |