Keithaiken (Talk | contribs) |
Keithaiken (Talk | contribs) |
||
Line 27: | Line 27: | ||
.contentDiv {display: inline-block; vertical-align: middle;} | .contentDiv {display: inline-block; vertical-align: middle;} | ||
− | # | + | /* PROTOCOL TABLE BEGINS */ |
− | + | #protocolTable {width: 700px;} | |
− | + | #protocolTable th {width: 350px;} | |
− | a: | + | #protocolTable th img {} |
− | a:active {color: #f5af3e; | + | #protocolTable tr {width: 700px; font-size: calc(14px + 0.5vw) !important; line-height: calc(1.1em + 0.5vw) !important; text-align: center !important; vertical-align: top;} |
+ | #protocolTable td {padding: 15px; width: 350px;} | ||
+ | #protocolTable .backWhite td {background-color: white;} | ||
+ | #protocolTable .backGrey td {background-color: whitesmoke;} | ||
+ | #protocolTable a:link {color: #041f39;} | ||
+ | #protocolTable a:active, #protocolTable a:hover {color: #f5af3e;} | ||
+ | #protocolTable a:visited {color: #377b7e;} | ||
+ | /* PROTOCOL TABLE ENDS */ | ||
/* PRODUCT REAGENT TABLE BEGINS */ | /* PRODUCT REAGENT TABLE BEGINS */ | ||
Line 47: | Line 54: | ||
</div> | </div> | ||
− | <div id=" | + | <center> |
− | < | + | <div> |
− | < | + | <table id="protocolTable"> |
− | < | + | <tr class="backWhite"> |
− | < | + | <td><a href="https://static.igem.org/mediawiki/2017/5/5f/Agarose_Gel_Extraction.pdf" target="_blank">Agarose Gel Extraction</a></td> |
− | < | + | <td><a href="https://static.igem.org/mediawiki/2017/6/66/Colony_PCR.pdf" target="_blank">Colony PCR</a></td> |
− | < | + | </tr> |
− | < | + | |
− | < | + | <tr class="backGrey"> |
− | < | + | <td><a href="https://static.igem.org/mediawiki/2017/6/6f/DNA_Purification_from_Enzymatic_Reactions.pdf" target="_blank">DNA PUrification from Enzymatic Reactions</a></td> |
− | < | + | <td><a href="https://static.igem.org/mediawiki/2017/5/51/In_vitro_transcription.pdf" target="_blank">In Vitro Transcription</a></td> |
− | < | + | </tr> |
− | < | + | |
− | < | + | <tr class="backWhite"> |
− | < | + | <td><a href="https://static.igem.org/mediawiki/2017/b/ba/LB_Media.pdf" target="_blank">LB Media</a></td> |
− | < | + | <td><a href="https://static.igem.org/mediawiki/2017/6/6c/Ligation_protocol.pdf" target="_blank">Ligations</a></td> |
− | < | + | </tr> |
− | < | + | |
− | < | + | <tr class="backGrey"> |
+ | <td><a href="https://static.igem.org/mediawiki/2017/6/68/PCR_Amplification.pdf" target="_blank">PCR Amplification</a></td> | ||
+ | <td><a href="https://static.igem.org/mediawiki/2017/e/e5/PCR_Product_Purification.pdf" target="_blank">PCR product Purification</a></td> | ||
+ | </tr> | ||
+ | |||
+ | <tr class="backWhite"> | ||
+ | <td><a href="https://static.igem.org/mediawiki/2017/d/df/PhenolChloroform_extraction_%26_ethanol_percipitation.pdf" target="_blank">Phenol/Chloroform Extraction and Ethanol Precipitation</a></td> | ||
+ | <td><a href="https://static.igem.org/mediawiki/2017/e/eb/PJET_Cloning.pdf">pJET Cloning</a></td> | ||
+ | </tr> | ||
+ | |||
+ | <tr class="backGrey"> | ||
+ | <td><a href="https://static.igem.org/mediawiki/2017/0/08/Plasmid_Miniprep.pdf">Plasmid Miniprep</a></td> | ||
+ | <td><a href="https://static.igem.org/mediawiki/2017/7/78/Preparation_of_Chemical_Competent_Cells.pdf">Preparation of Chemical Competent Cells</a></td> | ||
+ | </tr> | ||
+ | |||
+ | <tr class="backWhite"> | ||
+ | <td><a href="https://static.igem.org/mediawiki/2017/2/2c/Protein_Overexpression_.pdf">Protein Overexpression</a></td> | ||
+ | <td><a href="https://static.igem.org/mediawiki/2017/5/5f/PURExpress.pdf">PURExpress NEB Kit</a></td> | ||
+ | </tr> | ||
+ | |||
+ | <tr class="backGrey"> | ||
+ | <td><a href="https://static.igem.org/mediawiki/2017/f/fc/Purification_of_Poly-Histidine_Tagged_Proteins.pdf">Purification of Poly-Histidine Tagged Proteins</a></td> | ||
+ | <td><a href="https://static.igem.org/mediawiki/2017/1/10/Restriction_Enzyme_Digest_and_Dephosphorylation.pdf">Restriction Enzyme Digest and Dephosphorylation</a></td> | ||
+ | </tr> | ||
+ | |||
+ | <tr class="backWhite"> | ||
+ | <td><a href="https://static.igem.org/mediawiki/2017/2/2a/T7-RNA_Polymerase_Purification.pdf">T7- RNA Polymerase Purification</a></td> | ||
+ | <td><a href="https://static.igem.org/mediawiki/2017/a/a6/Transformation.pdf">Transformation</a></td> | ||
+ | </tr> | ||
+ | </table> | ||
</div> | </div> | ||
+ | </center> | ||
<br> | <br> | ||
Revision as of 20:38, 28 October 2017
![](https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png)
Protocols
Products/Reagents
Enzymes | Buffers/Reagents | Other Products |
---|---|---|
Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
Phusion Polymerase Master Mix | Kanomycin/Chloramphenicol/Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | Dialyzation Membrane |
PURExpressKit (New England Biolabs) | Phenol | |
XbaI (NEB) | Chloroform | |
SpeI (NEB) | 10x PFU Buffer | |
PstI (NEB) | NTP | |
EcoRI (NEB) | GMP | |
Dream Taq DNA Polymerase | 10x Taq Buffer | |
Taq DNA Polymerase | Ligase Buffer | |
RNAse A | SDS-PAGE Reagents | |
TraB | Urea PAGE reagents | |
iPPase | Agarose | |
RNAse Inhibitor | Agar | |
DNAseI | Tryptone | |
Yeast Extract | ||
TAKMz | BioBasic Plasmid DNA miniprep Kit | |
Imidazole |
![](https://static.igem.org/mediawiki/2017/7/7d/Banner_footer_blank.png)