Difference between revisions of "Team:Lethbridge/Software"

Line 5: Line 5:
 
<style>
 
<style>
 
/*SIDE MENU FOR IGEM STUFF*/
 
/*SIDE MENU FOR IGEM STUFF*/
#sideMenu{width: 200px;position: absolute;top: 20px;left: 1020px;z-index: 10;padding-top: 0px;padding-bottom: 15px;padding-left: 15px;padding-right: 15px;background-color: white;text-align: left;display: none;z-index: 9996;}
+
#sideMenu{width: 200px;position: absolute;top: 20px;left: 1020px;z-index: 10;padding-top: 0px;padding-bottom: 15px;padding-left: 15px;padding-right: 15px;background-color: white;text-align: left;display: none;z-index: 9996;}
 
#content{width: 100%;padding: 0px;margin-left: 0px;}
 
#content{width: 100%;padding: 0px;margin-left: 0px;}
 
#top_title{overflow: hidden;display: none;}
 
#top_title{overflow: hidden;display: none;}
Line 30: Line 30:
 
<body>
 
<body>
 
<div><img src="https://static.igem.org/mediawiki/2017/4/4d/Banner_HPsoftware.png"  class="center fit"></div>
 
<div><img src="https://static.igem.org/mediawiki/2017/4/4d/Banner_HPsoftware.png"  class="center fit"></div>
 
+
  <br><br>
<br><br>
+
  
 
<div>
 
<div>
 
    
 
    
 
<h1><span style="font-weight:normal;">One of these sequences is a toxin.</h1>
 
<h1><span style="font-weight:normal;">One of these sequences is a toxin.</h1>
<h1>Do you know which?</h1>
+
  <h1>Do you know which?</h1>
  
<p>ACAGTTACACGGACAACAAGGTGTTCCAGGCTTCTTTCCTCCCTTCGACGATGTATTTCCAATAGGTGTAATCGTCGGCGAAATCGTGTTCGGTTCTCCCGACGACTGCGAAGGAAACGGATTGTTCGGTGTATTCGGCGTGTACAGCAGAATTTCACCCGACAGCGGTCCTTCTTCACCAAATCCCAGCGGCGGCGG</p>
+
  <p class="pageText">ACAGTTACACGGACAACAAGGTGTTCCAGGCTTCTTTCCTCCCTTCGACGATGTATTTCCAATAGGTGTAATCGTCGGCGAAATCGTGTTCGGTTCTCCCGACGACTGCGAAGGAAACGGATTGTTCGGTGTATTCGGCGTGTACAGCAGAATTTCACCCGACAGCGGTCCTTCTTCACCAAATCCCAGCGGCGGCGG</p>
<p>CTGCGCGATGCTCGACGAGTCAATTCCGCTGTAGTACAGGAAGTCGTACGAGTCATTGCTATTGTATCAGCTAGAGATAATCGCGTACGCGCTCGAGCTCGAGCTATTTCGTCCTGAGCTGATGTCTCCGTCGATAATGAAAAATCCTCCGCTGATGTCCAGGTACAGACCCAGTCCGTCGTATCCTCCAATCGCTGA</p>
+
  <p class="pageText">CTGCGCGATGCTCGACGAGTCAATTCCGCTGTAGTACAGGAAGTCGTACGAGTCATTGCTATTGTATCAGCTAGAGATAATCGCGTACGCGCTCGAGCTCGAGCTATTTCGTCCTGAGCTGATGTCTCCGTCGATAATGAAAAATCCTCCGCTGATGTCCAGGTACAGACCCAGTCCGTCGTATCCTCCAATCGCTGA</p>
<p>GGTGCGAAGATTGACGACCCGCTCTATATTCATCATGTGTGGCCGCATGACCCGACAATTACACATTTCATTTTAAAGCTCGCGCATGCGATTGACATTGACATTACACTATATGAAATTAAGCCGTATCCGAAGCTCTGGCGTTATTATATTAAGCCGGTGCATGTGTCTGTGTATCCGCATTATTATCTCGCGGAA</p>
+
  <p class="pageText">GGTGCGAAGATTGACGACCCGCTCTATATTCATCATGTGTGGCCGCATGACCCGACAATTACACATTTCATTTTAAAGCTCGCGCATGCGATTGACATTGACATTACACTATATGAAATTAAGCCGTATCCGAAGCTCTGGCGTTATTATATTAAGCCGGTGCATGTGTCTGTGTATCCGCATTATTATCTCGCGGAA</p>
<p>AGGCACTTCCTACTTCTTAAGAAACGGCTAAGCAGCAGAGTTAAGAGCCTTAAGTCACTATCAAGCCCGCTAGTATTCAAACACAGCCACCTACTTCTACTTCTATCATGGCGGATGCTATTCAAGCGGAAGTTCAAAGTTTGCCGGCGGCTATTCAAGAGAAGCAGACCAAGACGGAAGAGCCGGCGGAAACACATG</p>
+
  <p class="pageText">AGGCACTTCCTACTTCTTAAGAAACGGCTAAGCAGCAGAGTTAAGAGCCTTAAGTCACTATCAAGCCCGCTAGTATTCAAACACAGCCACCTACTTCTACTTCTATCATGGCGGATGCTATTCAAGCGGAAGTTCAAAGTTTGCCGGCGGCTATTCAAGAGAAGCAGACCAAGACGGAAGAGCCGGCGGAAACACATG</p>
<!-- Nice try buddy. It's not that easy to find out. -->  
+
  <!-- Nice try buddy. It's not that easy to find out. -->  
  
<h2> V </h2>
+
<h2> V </h2>
 +
<br /><br />
  
 
<h1 class="segmentHeader"><span style="font-weight:normal;">The Next vivo Connection</h1>
 
<h1 class="segmentHeader"><span style="font-weight:normal;">The Next vivo Connection</h1>
 +
  <p>
 +
    In essence, our project is a rapidly purifiable cell-free system to bring the benefits of synthetic biology to as many people as possible. To do so, we provide methods to easily purify all of the necessary transcriptional and translational components. This includes proteins and RNAs- including functional tRNAs. Furthermore, the Next Vivo system lacks genomic DNA and is instead a minimal simple DNA input and protein output system. Because of these characteristics, Next vivo is highly amenable to genetic recoding.
 +
  </p>
 +
  <p>
 +
    Though there is some discussion surrounding the use of the term “Genetic Recoding” and “Codon Reassignment.” CITATION (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2921827/) Our system falls in between two proposed definitions, and we have chosen to refer to the practice as “Genetic Recoding” in the context of our project. (SIDEBAR?)
 +
  </p>
 +
  <p>
 +
    Genetic recoding is a process by which the conventional relationships between codon-anticodon and tRNA-amino acid are altered. For instance, the amber stop codon (UAG) can be reassigned to instead incorporate a natural or unnatural amino acid into a growing peptide. CITATION Modifying the relationship between codon and amino acid incorporation is equivalent to the creation of a novel genetic code. This has numerous benefits including the incorporation of unnatural amino acids, biocontainment, and protein engineering. (LINK OUT INTERNALLY, and then also BIELEFELD?)
 +
  </p>
 +
  <p>
 +
    Recoding can be accomplished via:
 +
  </p>
 +
  <ul>
 +
    <li>Introducing orthogonal tRNA-aaRS pairs CITATION</li>
 +
    <li>Mutating tRNA-aaRS pairs CITATION</li>
 +
    <li>tRNA misacylation by promiscuous RNA enzymes (Flexizymes) CITATION</li>
 +
  </ul>
 +
  <p>
 +
    Though this is a developing field, genetic recoding will only develop as scientific understanding and computational design improve. It is not hard to imagine the construction of a library of tRNAs that can be charged with non-canonical amino acids. Whether this is achieved via flexizymes or mutant pairs, selecting internally consistent sets of tRNAs and charging machinery will make it trivially easy to design a novel genetic code, and the Next vivo system would make it readily obtainable. 
 +
  </p>
 +
  <p>
 +
    When the available sample space provided by the genetic code is analyzed, recoding allows for a potential to generate numerous genetic codes according to the following formula:
 +
  </p>
 +
  <p>
 +
    Where n is the number of nucleic acid bases, l is the length of the codon, s is the number of switches, and a is the number of amino acids that need a codon.
 +
  </p>
 +
  <p>
 +
    At a minimum, a single switch means that there are 64 potential internally consistent genetic codes available. When all codons are reassigned, a simplistic estimation (64!/20!) suggests that there are 5.21 x 10^70 possible combinations available. This is a really really large sample space to search combinatorially. However, it remains to be seen whether or not this relationship is cryptographically strong.
 +
  </p>
 +
  <p>
 +
    <b>The apparent risk of this technology is that genetic recoding may allow harmful sequences to be “encrypted”, thus masking the information contained within while retaining the ability to faithfully produce the encoded protein. </b>
 +
  </p>
 +
  <p>
 +
    The potential for harm as a result of this technology is not to be underestimated. If recoded systems become as prevalent and easy to obtain as we expect them to be, control over where toxin sequences are sent greatly diminishes. Accordingly, we reached out to gene synthesis companies to determine whether or not current bioinformatic technologies can detect radically re-coded toxin sequences.
 +
  </p>
 +
  <p>
 +
    Following this reached out to all current members of the IGSC asking them to screen twelve sequences for us. Of the five companies that were willing to help us, all of them correctly identified the un-encrypted toxic proteins. However, no organization could correctly identify the encrypted toxins. The data is available here to try for yourself: LINK TO DATA SET?
 +
  </p>
  
<p class="pageText">As an additional tool outside the Next vivo system, we developed a construct that can be used to measure the amount of transcription, translation, or both! The details of this construct can be found on the design page (link).
 
Using a purified T7 polymerase we in vitro transcribed the full validation construct. After adding DHFBI, the fluorophore, we were able to observe green fluorescence (Figure 2).</p>
 
 
<p class="pageText">Will’s spinach figure.</p>
 
 
<p class="pageText">Figure 2 - Characterization of the EYFP-Spinach validation construct. </p>
 
 
<p class="pageText">From these results we are confident that we can produce the Spinach RNA and use it as a measure of transcriptional activity for our Next vivo system or T7 polymerase alone.</p>
 
 
            <h1 class="segmentHeader"><span style="font-weight:normal;">tRNA Purification</h1>
 
 
<p class="pageText">The biggest issue we initially faced in developing Next vivo was determining how we could purify tRNA quickly and efficiently. The solution we decided upon was an adapted MS2 purification combined with a subsequent incubation with RNase H and a DNA oligo that would selectively cleavage and release a tRNA of the proper size. For more information on the design, see the tRNA purification section here. (link)</p>
 
 
<p class="pageText">Both the tRNAPhe-MS2 construct and MS2BP were expressed individually in E. coli BL21 DE3 cells. Upon which time the cells were lysed, the lysate combined, and applied to a Nickel-sepharose affinity column. The MS2BP is able to bridge the nickel sepharose column and the tRNA-MS2 allowing the tRNA to be isolated from the cell lysate.</p>
 
 
<p class="pageText">Graeme’s illustrious post and pre cigarette images of tRNA purification.</p>
 
 
<p class="pageText">Figure Y - Whatever Graeme has.
 
</p>
 
 
            <h1 class="segmentHeader"><span style="font-weight:normal;">Transcription Validation</h1>
 
 
            <h1 class="segmentHeader"><span style="font-weight:normal;">Future Plans</h1>
 
 
<p class="pageText">Work on the Next vivo system will not end with the iGEM competition and will be carried on by several team members going forward.
 
 
<ul class='pageText'>
 
<li>Perform the multi-protein purification with all Next vivo TX-TL components
 
<li>Test purified tRNAPhe for aminoacylation efficiency (how efficient the amino acid can be attached)
 
<li>Design and order the remaining 19 tRNA needed to encode the 20 standard amino acids
 
<li>Insert the MS2 tag into the ribosomal RNA genes to test purification of the ribosome
 
<li>Test Next vivo purified release factors (translation components) in the PUREexpress kits lacking these factors for viability
 
<li>Design a troubleshooting module to determine which components are non-functional
 
 
</ul>
 
</p>
 
</div>
 
  
 
</div>
 
</div>
 
</body>
 
</body>
 
</html>
 
</html>

Revision as of 01:21, 29 October 2017



One of these sequences is a toxin.

Do you know which?

ACAGTTACACGGACAACAAGGTGTTCCAGGCTTCTTTCCTCCCTTCGACGATGTATTTCCAATAGGTGTAATCGTCGGCGAAATCGTGTTCGGTTCTCCCGACGACTGCGAAGGAAACGGATTGTTCGGTGTATTCGGCGTGTACAGCAGAATTTCACCCGACAGCGGTCCTTCTTCACCAAATCCCAGCGGCGGCGG

CTGCGCGATGCTCGACGAGTCAATTCCGCTGTAGTACAGGAAGTCGTACGAGTCATTGCTATTGTATCAGCTAGAGATAATCGCGTACGCGCTCGAGCTCGAGCTATTTCGTCCTGAGCTGATGTCTCCGTCGATAATGAAAAATCCTCCGCTGATGTCCAGGTACAGACCCAGTCCGTCGTATCCTCCAATCGCTGA

GGTGCGAAGATTGACGACCCGCTCTATATTCATCATGTGTGGCCGCATGACCCGACAATTACACATTTCATTTTAAAGCTCGCGCATGCGATTGACATTGACATTACACTATATGAAATTAAGCCGTATCCGAAGCTCTGGCGTTATTATATTAAGCCGGTGCATGTGTCTGTGTATCCGCATTATTATCTCGCGGAA

AGGCACTTCCTACTTCTTAAGAAACGGCTAAGCAGCAGAGTTAAGAGCCTTAAGTCACTATCAAGCCCGCTAGTATTCAAACACAGCCACCTACTTCTACTTCTATCATGGCGGATGCTATTCAAGCGGAAGTTCAAAGTTTGCCGGCGGCTATTCAAGAGAAGCAGACCAAGACGGAAGAGCCGGCGGAAACACATG

V



The Next vivo Connection

In essence, our project is a rapidly purifiable cell-free system to bring the benefits of synthetic biology to as many people as possible. To do so, we provide methods to easily purify all of the necessary transcriptional and translational components. This includes proteins and RNAs- including functional tRNAs. Furthermore, the Next Vivo system lacks genomic DNA and is instead a minimal simple DNA input and protein output system. Because of these characteristics, Next vivo is highly amenable to genetic recoding.

Though there is some discussion surrounding the use of the term “Genetic Recoding” and “Codon Reassignment.” CITATION (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2921827/) Our system falls in between two proposed definitions, and we have chosen to refer to the practice as “Genetic Recoding” in the context of our project. (SIDEBAR?)

Genetic recoding is a process by which the conventional relationships between codon-anticodon and tRNA-amino acid are altered. For instance, the amber stop codon (UAG) can be reassigned to instead incorporate a natural or unnatural amino acid into a growing peptide. CITATION Modifying the relationship between codon and amino acid incorporation is equivalent to the creation of a novel genetic code. This has numerous benefits including the incorporation of unnatural amino acids, biocontainment, and protein engineering. (LINK OUT INTERNALLY, and then also BIELEFELD?)

Recoding can be accomplished via:

  • Introducing orthogonal tRNA-aaRS pairs CITATION
  • Mutating tRNA-aaRS pairs CITATION
  • tRNA misacylation by promiscuous RNA enzymes (Flexizymes) CITATION

Though this is a developing field, genetic recoding will only develop as scientific understanding and computational design improve. It is not hard to imagine the construction of a library of tRNAs that can be charged with non-canonical amino acids. Whether this is achieved via flexizymes or mutant pairs, selecting internally consistent sets of tRNAs and charging machinery will make it trivially easy to design a novel genetic code, and the Next vivo system would make it readily obtainable.

When the available sample space provided by the genetic code is analyzed, recoding allows for a potential to generate numerous genetic codes according to the following formula:

Where n is the number of nucleic acid bases, l is the length of the codon, s is the number of switches, and a is the number of amino acids that need a codon.

At a minimum, a single switch means that there are 64 potential internally consistent genetic codes available. When all codons are reassigned, a simplistic estimation (64!/20!) suggests that there are 5.21 x 10^70 possible combinations available. This is a really really large sample space to search combinatorially. However, it remains to be seen whether or not this relationship is cryptographically strong.

The apparent risk of this technology is that genetic recoding may allow harmful sequences to be “encrypted”, thus masking the information contained within while retaining the ability to faithfully produce the encoded protein.

The potential for harm as a result of this technology is not to be underestimated. If recoded systems become as prevalent and easy to obtain as we expect them to be, control over where toxin sequences are sent greatly diminishes. Accordingly, we reached out to gene synthesis companies to determine whether or not current bioinformatic technologies can detect radically re-coded toxin sequences.

Following this reached out to all current members of the IGSC asking them to screen twelve sequences for us. Of the five companies that were willing to help us, all of them correctly identified the un-encrypted toxic proteins. However, no organization could correctly identify the encrypted toxins. The data is available here to try for yourself: LINK TO DATA SET?