Keithaiken (Talk | contribs) |
Keithaiken (Talk | contribs) |
||
Line 26: | Line 26: | ||
@media only screen and (max-width: 500px) { | @media only screen and (max-width: 500px) { | ||
− | #proreaTable { | + | #proreaTable {width: 490px}} |
</style> | </style> | ||
<body> | <body> |
Revision as of 20:32, 29 October 2017
![](https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png)
Protocols
Products/Reagents
Enzymes | Buffers/Reagents | Other Products |
---|---|---|
Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
Phusion Polymerase Master Mix | Kanomycin / Chloramphenicol / Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | Dialyzation Membrane |
PURExpressKit (New England Biolabs) | Phenol | |
XbaI (NEB) | Chloroform | |
SpeI (NEB) | 10x PFU Buffer | |
PstI (NEB) | NTP | |
EcoRI (NEB) | GMP | |
Dream Taq DNA Polymerase | 10x Taq Buffer | |
Taq DNA Polymerase | Ligase Buffer | |
RNAse A | SDS-PAGE Reagents | |
TraB | Urea PAGE reagents | |
iPPase | Agarose | |
RNAse Inhibitor | Agar | |
DNAseI | Tryptone | |
Yeast Extract | ||
TAKMz | ||
BioBasic Plasmid DNA miniprep Kit | ||
Imidazole |
![](https://static.igem.org/mediawiki/2017/7/7d/Banner_footer_blank.png)