Difference between revisions of "Team:Lethbridge/Experiments"

 
(7 intermediate revisions by 3 users not shown)
Line 3: Line 3:
 
{{Team:Lethbridge/navbar}}
 
{{Team:Lethbridge/navbar}}
 
{{Team:Lethbridge/assets/allpages.css}}
 
{{Team:Lethbridge/assets/allpages.css}}
 +
{{Team:Lethbridge/top}}
 
<html>
 
<html>
 
<style>
 
<style>
Line 134: Line 135:
 
     <td>T7 DNA Polymerase</td>
 
     <td>T7 DNA Polymerase</td>
 
     <td>T7 RNA Polymerase Purification Buffers</td>
 
     <td>T7 RNA Polymerase Purification Buffers</td>
     <td>Dialyzation Membrane</td>
+
     <td>Dialysis Tubing</td>
 
   </tr>
 
   </tr>
 
   <tr>
 
   <tr>
Line 172: Line 173:
 
</tr>
 
</tr>
 
<tr>
 
<tr>
       <td>RNAse A</td>
+
       <td>RNase A</td>
 
       <td>SDS-PAGE Reagents</td>
 
       <td>SDS-PAGE Reagents</td>
 
     <td></td>
 
     <td></td>
Line 187: Line 188:
 
</tr>
 
</tr>
 
<tr>
 
<tr>
     <td>RNAse Inhibitor</td>
+
     <td>RNase Inhibitor</td>
 
     <td>Agar</td>
 
     <td>Agar</td>
 
     <td></td>
 
     <td></td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
     <td>DNAseI</td>
+
     <td>DNaseI</td>
 
     <td>Tryptone</td>
 
     <td>Tryptone</td>
 
     <td></td>
 
     <td></td>

Latest revision as of 03:07, 2 November 2017


Protocols


Products/Reagents

Enzymes Buffers/Reagents Other Products
Shrimp Alkaline Phosphatase Affinity Chromatography Buffers Ni²+ Affinity Resin
DNA Blunting Enzyme IPTG Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’
Phusion Polymerase Master Mix Kanomycin / Chloramphenicol / Ampicillin Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’
PFU Polymerase Dimethyl Sulfur Dioxide Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’
T7 RNA Polymerase Competent Cell Buffers Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’
T7 DNA Polymerase T7 RNA Polymerase Purification Buffers Dialysis Tubing
PURExpressKit (New England Biolabs) Phenol
XbaI (NEB) Chloroform
SpeI (NEB) 10x PFU Buffer
PstI (NEB) NTP
EcoRI (NEB) GMP
Dream Taq DNA Polymerase 10x Taq Buffer
Taq DNA Polymerase Ligase Buffer
RNase A SDS-PAGE Reagents
TraB Urea PAGE reagents
iPPase Agarose
RNase Inhibitor Agar
DNaseI Tryptone
Yeast Extract
TAKMz
BioBasic Plasmid DNA miniprep Kit
Imidazole