Difference between revisions of "Team:SUSTech Shenzhen/Parts"

(Undo revision 505438 by Jol-Fengzi (talk))
 
(43 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
{{:Team:SUSTech_Shenzhen/removeStyles}}
 
{{:Team:SUSTech_Shenzhen/removeStyles}}
−
{{:Team:SUSTech_Shenzhen/theme}}
+
{{:Team:SUSTech_Shenzhen/nav}}<!--------子页面导航栏------------------------------------>
−
{{:Team:SUSTech_Shenzhen/nav}}
+
−
{<html>
+
−
<body>
+
−
<div class="container" align="center">
+
−
    <h3>Demonstrate</h3><br>
+
−
    <ul class="nav nav-pills">
+
−
      <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Parts#Parts">Composite Parts</a></li>
+
−
      <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Parts#Achievements">Achievements</a></li>
+
−
  <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Results">Results</a></li>
+
−
      <li class="active"><a href="#">Demonstrate our work</a></li>
+
−
      <li><a href="https://2016.igem.org/Team:Hong_Kong_HKU/Proof">Proof of Concept</a></li>
+
−
    </ul>
+
−
    <p class="text-justify" align="left">
+
−
    <br><font size="4"><b>RNA detection using DNA nanostructure</b></font><br><br>
+
−
    <font size="3">
+
−
    After showing that our DNA nanostructures can detect our target DNA (details can be found <a href="https://2016.igem.org/Team:Hong_Kong_HKU/Results">here</a>), we went further to detect RNA. 
+
−
    This test aimed to simulate the detection of serum microRNA, which has potential real-world application to diagnose disease using microRNA disease biomarkers. 
+
−
    The following table shows the sequence of input used in the assay.<br><br>
+
−
    </font></p>
+
−
    <table class="table">
+
−
        <thead>
+
−
            <tr>
+
−
            <th></th>
+
−
                <th>Sequence</th> 
+
−
                <th>Length</th>
+
−
            </tr>
+
−
        </thead>
+
−
        <tbody>
+
−
            <tr>
+
−
                <td>RNA Input</td>
+
−
                <td>CAAUCAGGGUCUAACUCCACUGGGUGCCAU</td>
+
−
                <td>30</td>
+
−
            </tr>
+
−
            <tr>
+
−
                <td>RNA Mutant</td>
+
−
                <td>CAGGCAGUAUCAUGCGACAUUGGGUGCAGC</td>
+
−
                <td>30</td>
+
−
            </tr>
+
−
        </tbody>
+
−
    </table>
+
−
    <p class="text-justify" align="left"><font size="3">
+
−
    First, we used our simplified DNA nanostructure (formed from the G-quadruplex side of O1 and O5 of the tetrahedron, 
+
−
    which is the essential part of the 3D tetrahedral nanostructure) to detect RNA input.
+
−
    Equimolar (100nM final) DNA nanostructure and RNA input were added in the assay. 
+
−
    The following bar chart shows the absorbance at 420nm after the addition of different RNAs.<br><br>
+
−
    </font></p>
+
−
    <img class="img-responsive center-block" src="https://static.igem.org/mediawiki/2016/5/59/T--Hong_Kong_HKU--O1O5RNAmutant.png" alt="" width="800px" height="auto">
+
−
    <p class="text-justify" align="left"><font size="3">
+
−
    Fig. A: Absorbance at 420nm after the addition of different RNAs to the simplified DNA nanostructure (formed from O1's G-quadruplex side and O5 of the tetrahedron) which is termed as  "beacon" in the above graph. 
+
−
    The absorbance was taken 15 minutes after the addition of ABTS and H2O2. Error bars show standard deviation from triplicates.<br><br>
+
−
    Then, we repeated the experiment using our tetrahedral DNA nanostructure, which gave the following result.<br><br>
+
−
    </font></p>
+
−
    <img class="img-responsive center-block" src="https://static.igem.org/mediawiki/2016/7/7f/T--Hong_Kong_HKU--TetraRNAmutant.png" alt="" width="800px" height="auto">
+
−
    <p class="text-justify" align="left"><font size="3">
+
−
    Fig. B: Absorbance at 420nm after the addition of different RNAs to the tetrahedral DNA nanostructure. 
+
−
    The absorbance was taken 15 minutes after the addition of ABTS and H<sub>2</sub>O<sub>2</sub>. Error bars show standard deviation from triplicates.<br>
+
−
    From the above two graphs, it can be seen that the addition of RNA input resulted in a higher absorbance than that without the addition of RNA input, and the addition of a random RNA sequence did not lead to a higher absorbance.
+
−
    Hence, we have successfully demonstrated that our design not only can detect our desired RNA, it can also distinguish the correct RNA input from a random RNA.<br><br>
+
−
    </font>
+
−
    <font size="4"><b>Limit of detection</b></font><br><br>
+
−
    <font size="3">
+
−
    Then, we determined the limit of detection (LOD) of our detection beacon (formed from O1's G-quadruplex side and O5 of the tetrahedron, the active component of the tetrahedral nanostructure) by ABTS assay. 
+
−
    Different concentrations of RNA input were added and their respective absorbance at 420nm was measured. 
+
−
    A regression line obtained is shown in the following graph.
+
−
    </font></p>
+
−
    <img class="img-responsive center-block" src="https://static.igem.org/mediawiki/2016/1/12/T--Hong_Kong_HKU--O1O5RNALOD.png" alt="" width="800px" height="auto">
+
−
    <p class="text-justify" align="left"><font size="3">
+
−
    Fig. C: Absorbance at 420nm against the concentration of RNA input to the simplified DNA nanostructure (formed from O1's G-quadruplex side and O5 of the tetrahedron).
+
−
    The absorbance was taken 15 minutes after the addition of ABTS and H<sub>2</sub>O<sub>2</sub>. Error bars show standard deviation from triplicates.
+
−
    The regression line obtained is <i>y</i>=0.0009<i>x</i>+0.1298 (R<sup>2</sup>=0.9739).
+
−
    The LOD is calculated as follows.<br><br>
+
−
    C<sub>LOD</sub> = 3(s<sub><i>y</i>/<i>x</i></sub>)÷<i>b</i>,  where<br><br>
+
−
    C<sub>LOD</sub> is the concentration LOD,<br>
+
−
    s<sub><i>y</i>/<i>x</i></sub> is the standard error of regression, and<br>
+
−
    <i>b</i> is the slope of regression line.<br><br>
+
−
    First, the standard error of regression is determined.<br><br>
+
−
    </font></p>
+
−
      <table class="table">
+
−
        <thead>
+
−
            <tr>
+
−
                <th style="text-align:center"><i>X</i></th>
+
−
                <th style="text-align:center"><i>Y</i></th>
+
−
                <th style="text-align:center"><i>Y'</i></th>
+
−
                <th style="text-align:center"><i>Y</i>-<i>Y'</i></th>
+
−
                <th style="text-align:center">(<i>Y</i>-<i>Y'</i>)<sup>2</sup></th>
+
−
            </tr>
+
−
        </thead>
+
−
        <tbody>
+
−
            <tr>
+
−
                <td style="text-align:center">0</td>
+
−
                <td style="text-align:center">0.123333333333333</td>
+
−
                <td style="text-align:center">0.1298</td>
+
−
                <td style="text-align:center">-0.00646666666666666</td>
+
−
                <td style="text-align:center">0.0000418177777777777</td>
+
−
            </tr>
+
−
            <tr>
+
−
                <td style="text-align:center">20</td>
+
−
                <td style="text-align:center">0.151</td>
+
−
                <td style="text-align:center">0.1478</td>
+
−
                <td style="text-align:center">0.00320000000000001</td>
+
−
                <td style="text-align:center">0.0000102400000000001</td>
+
−
            </tr>
+
−
            <tr>
+
−
                <td style="text-align:center">40</td>
+
−
                <td style="text-align:center">0.170666666666667</td>
+
−
                <td style="text-align:center">0.1658</td>
+
−
                <td style="text-align:center">0.00486666666666666</td>
+
−
                <td style="text-align:center">0.0000236844444444444</td>
+
−
            </tr>
+
−
            <tr>
+
−
                <td style="text-align:center">60</td>
+
−
                <td style="text-align:center">0.185666666666667</td>
+
−
                <td style="text-align:center">0.1838</td>
+
−
                <td style="text-align:center">0.00186666666666666</td>
+
−
                <td style="text-align:center">0.0000034844444444444</td>
+
−
            </tr>
+
−
            <tr>
+
−
                <td style="text-align:center">80</td>
+
−
                <td style="text-align:center">0.208333333333333</td>
+
−
                <td style="text-align:center">0.2018</td>
+
−
                <td style="text-align:center">0.00653333333333336</td>
+
−
                <td style="text-align:center">0.0000426844444444448</td>
+
−
            </tr>
+
−
            <tr>
+
−
                <td style="text-align:center">100</td>
+
−
                <td style="text-align:center">0.213666666666667</td>
+
−
                <td style="text-align:center">0.2198</td>
+
−
                <td style="text-align:center">-0.00613333333333332</td>
+
−
                <td style="text-align:center">0.0000376177777777777</td>
+
−
            </tr>
+
−
            <tr>
+
−
                <td style="text-align:center" colspan="5"> </td>
+
−
            </tr>
+
−
            <tr>
+
−
                <th style="text-align:center" colspan="2">SSE</th>
+
−
                <td style="text-align:center" colspan="3">0.000159528888888889</td>
+
−
            </tr>
+
−
        </tbody>
+
−
      </table>
+
−
    <p class="text-justify" align="left"><font size="3">
+
−
    (<i>Y'</i> is the predicted value from the regression line <i>y</i>=0.0009<i>x</i>+0.1298)<br><br>
+
−
    Standard error of regression = √(SSE÷no. of pairs)=√(0.0001595÷6)=0.005156<br><br>
+
−
    Limit of detection<br>
+
−
    C<sub>LOD</sub> = 3(s<sub><i>y</i>/<i>x</i></sub>)÷<i>b</i> = 3(0.005156)÷0.0009 = 17.19nM<br><br>
+
−
    </font>
+
−
    <br><font size="4"><b>Real-world application</b></font><br><br>
+
−
  <font size="3">
+
−
  Our DNA nanostructures can potentially be utilized as a simple diagnostic tool, where a higher absorbance in ABTS assay suggests the presence of our desired RNA target.
+
−
    As microRNAs are potential disease biomarkers, our DNA nanostructures can potentially be used in disease screening by detecting the patien' s serum microRNA.
+
−
    In addition, we can easily expand the application to detect different RNA sequences by modifying the sequence of two strands of our DNA nanostructure.
+
−
    </font></p>
+
−
</div>
+
  
−
<!-- footer -->
+
{{:Team:SUSTech_Shenzhen/themeCss}}<!--------整体布局，勿动------------------------------->
−
<footer class="text-center"></footer>
+
{{:Team:SUSTech_Shenzhen/templates/page-header-part|title=Parts|subtitle=Contribution}}
−
<script src="https://2016.igem.org/Team:Hong_Kong_HKU/JS/jQuery?action=raw&ctype=text/javascript" type="text/javascript"></script>
+
{{:Team:SUSTech_Shenzhen/main-content-begin}}<!---------内容的样式---------------->
−
<script src="https://2016.igem.org/Template:Hong_Kong_HKU/js/script?action=raw&ctype=text/javascript" type="text/javascript"></script>
+
<html><style>.btn {font-size: 20px;color:white;}
−
</body>
+
.btn-primary {background: #27c5ee;}</style></html>
−
</html>
+
<!--------往下直接写内容----------------->
  
 +
{|class="table table-striped"
 +
! '''Category '''
 +
! '''Name'''
 +
! '''Description'''
 +
|-
 +
|  Coding
 +
| <partinfo>BBa_K2492001</partinfo>
 +
| CoChR
 +
 +
|-
 +
| Reporter
 +
| <partinfo>BBa_K2492000</partinfo>
 +
| GFP optimized with three introns for <i>C.elegans</i>
 +
|-
 +
|  Reporter
 +
| <partinfo>BBa_K2492002</partinfo>
 +
|mCherry optimized  with three introns for <i>C.elegans</i>
 +
|-
 +
|  Coding
 +
| <partinfo>BBa_K2492003</partinfo>
 +
| GEM-GECO calcium indicator
 +
|-
 +
|  Promoter
 +
| <partinfo>BBa_K2492004</partinfo>
 +
|  Odr-10
 +
|-
 +
|}
 +
Since our project is based on ontogenetic tools to manipulate the neuron activity, we submit five basic parts which are essential for achieving our goals. This collection provides several parts which are used as promoter in certain neuron, light sensor, activation indicator and location reporter.
 +
 +
One of important constructed plasmid is Pord-10::CoChR::GEM-GECO::mCherry. Part BBa_K2492004 (Podr-10)provides an neuron AWA specific promoter which drives channelrhodopsins and calcium indicator specifically expressed in AWA. Part BBa_K2492001(CoChR) provides channelrodopsin(CoChR), which serves as a light switch. In order an part to manipulate neuron activity through ~470nm excitation light, we choose this part, which is benefit for sensitive to blue light. BBa_K2492003(GEM-GECO) is an calcium ions indicator part, it provides the function of monitoring and responding to the concentration of calcium ions. This part provides us with more direct visualisation of neuron activity. Part BBa_K2492002 codes mCherry, which indicates the position of neuron AWA. This fluorescence reporter direct reveals the position of transgenic neurons and roughly estimate the expression level of injected plasmids. Part BBa_K2492000 is GFP for <i>C.elegans</i>. Both reporter proteins(GFP and mCherry) are modified, which enables the good expression in <i>C.elegans</i>.
 +
 +
Thus, we provide a collection of parts work together to manipulate and visualize neurons in <i>C.elegans</i>.
 +
 +
<html>
 +
<a class="btn btn-default" style="color:black;font-size:14px" href="https://2017.igem.org/Team:SUSTech_Shenzhen/Basic_Part"><i class="ion-arrow-right-c"></i> See the Basic parts page</a>
 +
 +
</html>
 +
{{:Team:SUSTech_Shenzhen/main-content-end}}<!---------内容的样式----------------->
 
{{:Team:SUSTech_Shenzhen/wiki-footer}}
 
{{:Team:SUSTech_Shenzhen/wiki-footer}}
 +
{{:Team:SUSTech_Shenzhen/themeJs}}<!--------布局居中------------->

Latest revision as of 02:03, 15 December 2017

Team SUSTC-Shenzhen

Parts

Contribution


Category Name Description
Coding <partinfo>BBa_K2492001</partinfo> CoChR
Reporter <partinfo>BBa_K2492000</partinfo> GFP optimized with three introns for C.elegans
Reporter <partinfo>BBa_K2492002</partinfo> mCherry optimized with three introns for C.elegans
Coding <partinfo>BBa_K2492003</partinfo> GEM-GECO calcium indicator
Promoter <partinfo>BBa_K2492004</partinfo> Odr-10

Since our project is based on ontogenetic tools to manipulate the neuron activity, we submit five basic parts which are essential for achieving our goals. This collection provides several parts which are used as promoter in certain neuron, light sensor, activation indicator and location reporter.

One of important constructed plasmid is Pord-10::CoChR::GEM-GECO::mCherry. Part BBa_K2492004 (Podr-10)provides an neuron AWA specific promoter which drives channelrhodopsins and calcium indicator specifically expressed in AWA. Part BBa_K2492001(CoChR) provides channelrodopsin(CoChR), which serves as a light switch. In order an part to manipulate neuron activity through ~470nm excitation light, we choose this part, which is benefit for sensitive to blue light. BBa_K2492003(GEM-GECO) is an calcium ions indicator part, it provides the function of monitoring and responding to the concentration of calcium ions. This part provides us with more direct visualisation of neuron activity. Part BBa_K2492002 codes mCherry, which indicates the position of neuron AWA. This fluorescence reporter direct reveals the position of transgenic neurons and roughly estimate the expression level of injected plasmids. Part BBa_K2492000 is GFP for C.elegans. Both reporter proteins(GFP and mCherry) are modified, which enables the good expression in C.elegans.

Thus, we provide a collection of parts work together to manipulate and visualize neurons in C.elegans.

See the Basic parts page

Made by from the elegans.Inc in SUSTech_Shenzhen.

Licensed under CC BY 4.0.

  • ©2017 SUSTech_Shenzhen