Difference between revisions of "Team:Lethbridge/Experiments"

Line 19: Line 19:
 
<div><img src="https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png"  class="center fit"></div>
 
<div><img src="https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png"  class="center fit"></div>
  
−
<p><a href="protocol html">Agarose Gel Extraction</a></p>  
+
<p><a href=protocol">LB Media</a></p>
 +
 
 +
<p><a href=protocol">Agarose Gel Extraction</a></p>  
 +
 
 +
<p><a href=protocol">PCR Amplification</a></p>
 +
 
 +
<p><a href=protocol">Colony PCR</a></p>
 +
 
 +
<p><a href=protocol">DNA PUrification from Enzymatic Reactions</a></p>
 +
 
 +
<p><a href=protocol">PCR product Purification</a></p>
 +
 
 +
<p><a href=protocol">In Vitro Transcription</a></p>
 +
 
 +
<p><a href=protocol">Ligations</a></p>
 +
 
 +
<p><a href=protocol">Phenol/Chloroform Extraction and Ethanol Precipitation</a></p>
 +
 
 +
<p><a href=protocol">pJET Cloning</a></p>
 +
 
 +
<p><a href=protocol">Plasmid Miniprep</a></p>
 +
 
 +
<p><a href=protocol">Preparation of Chemical Competent Cells</a></p>
 +
 
 +
<p><a href=protocol">Protein Overexpression</a></p>
 +
 
 +
<p><a href=protocol">PURExpress NEB Kit</a></p>
 +
 
 +
<p><a href=protocol">Purification of Poly-Histidine Tagged Proteins</a></p>
 +
 
 +
<p><a href=protocol">Restriction Enzyme Digest and Dephosphorylation</a></p>
 +
 
 +
<p><a href=protocol">T7- RNA Polymerase Purification</a></p>
 +
 
 +
<p><a href=protocol">Transformation</a></p>
 +
 +
 
 +
table {
 +
    font-family: arial, sans-serif;
 +
    border-collapse: collapse;
 +
    width: 100%;
 +
}
 +
 
 +
td, th {
 +
    border: 1px solid black;
 +
    text-align: left;
 +
    padding: 8px;
 +
}
 +
 
 +
tr:nth-child(even) {
 +
    background-color: white;
 +
}
 +
</style>
 +
</head>
 +
<body>
 +
 
 +
<table>
 +
  <tr>
 +
    <th>Enzymes</th>
 +
    <th>Buffers/Reagents</th>
 +
    <th>Other Products</th>
 +
  </tr>
 +
  <tr>
 +
    <td>Shrimp Alkaline Phosphatase</td>
 +
    <td>Affinity Chromatography Buffers</td>
 +
  <td>Ni²+ Affinity Resin</td>
 +
  </tr>
 +
  <tr>
 +
    <td>DNA Blunting Enzyme</td>
 +
    <td>IPTG</td>
 +
  <td>Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’</td>
 +
</td>
 +
  </tr>
 +
  <tr>
 +
    <td>Phusion Polymerase Master Mix</td>
 +
    <td>Kanomycin/Chloramphenicol/Ampicillin </td>
 +
  <td>Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’</td>
 +
  </tr>
 +
  <tr>
 +
    <td>PFU Polymerase</td>
 +
    <td>Dimethyl Sulfur Dioxide</td>
 +
  <td>Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’</td>
 +
  </tr>
 +
  <tr>
 +
    <td>T7 RNA Polymerase</td>
 +
    <td>Competent Cell Buffers</td>
 +
  <td>Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’</td>
 +
  </tr>
 +
  <tr>
 +
    <td>T7 DNA Polymerase</td>
 +
    <td>T7 RNA Polymerase Purification Buffers</td>
 +
    <td></td>
 +
  </tr>
 +
  <tr>
 +
    <td>PURExpressKit (New England Biolabs)</td>
 +
    <td>Phenol </td>
 +
  <td></td>
 +
  </tr>
 +
  <tr>
 +
    <td>XbaI (NEB)</td>
 +
    <td>Chloroform</td>
 +
  <td></td>
 +
  </tr>
 +
<tr>
 +
    <td>SpeI (NEB)</td>
 +
    <td>10x PFU Buffer</td>
 +
    <td></td>
 +
</tr>
 +
<tr>
 +
    <td>PstI (NEB)</td>
 +
    <td>NTP</td>
 +
    <td></td>
 +
</tr>
 +
<tr>
 +
      <td>EcoRI (NEB)</td>
 +
      <td>GMP</td>
 +
    <td></td>
 +
</tr>
 +
<tr>
 +
      <td>Dream Taq DNA Polymerase</td>
 +
      <td>10x Taq Buffer</td>
 +
      <td></td>
 +
</tr>
 +
<tr>
 +
      <td>Taq DNA Polymerase</td>
 +
    <td>Ligase Buffer</td>
 +
    <td></td>
 +
</tr>
 +
<tr>
 +
      <td>RNAse A</td>
 +
      <td>SDS-PAGE Reagents</td>
 +
    <td></td>
 +
</tr>
 +
<tr>
 +
      <td>TraB</td>
 +
      <td>Urea PAGE reagents</td>
 +
      <td></td>
 +
</tr>
 +
<tr>
 +
      <td>iPPase</td>
 +
    <td>Agarose</td>
 +
    <td></td>
 +
</tr>
 +
<tr>
 +
    <td>RNAse Inhibitor</td>
 +
    <td>Agar</td>
 +
    <td></td>
 +
</tr>
 +
<tr>
 +
    <td>Tryptone</td>
 +
    <td></td>
 +
    <td></td>
 +
</tr>
 +
<tr>
 +
    <td>Yeast Extract</td>
 +
    <td></td>
 +
  <td></td>
 +
</tr>
 +
<tr>
 +
    <td>BioBasic Plasmid DNA miniprep Kit </td>
 +
    <td></td>
 +
    <td></td>
 +
</table>
 +
 
 
</body>
 
</body>
 
</html>
 
</html>

Revision as of 20:17, 27 October 2017

LB Media

Agarose Gel Extraction

PCR Amplification

Colony PCR

DNA PUrification from Enzymatic Reactions

PCR product Purification

In Vitro Transcription

Ligations

Phenol/Chloroform Extraction and Ethanol Precipitation

pJET Cloning

Plasmid Miniprep

Preparation of Chemical Competent Cells

Protein Overexpression

PURExpress NEB Kit

Purification of Poly-Histidine Tagged Proteins

Restriction Enzyme Digest and Dephosphorylation

T7- RNA Polymerase Purification

Transformation

table { font-family: arial, sans-serif; border-collapse: collapse; width: 100%; } td, th { border: 1px solid black; text-align: left; padding: 8px; } tr:nth-child(even) { background-color: white; }
Enzymes Buffers/Reagents Other Products
Shrimp Alkaline Phosphatase Affinity Chromatography Buffers Ni²+ Affinity Resin
DNA Blunting Enzyme IPTG Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’
Phusion Polymerase Master Mix Kanomycin/Chloramphenicol/Ampicillin Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’
PFU Polymerase Dimethyl Sulfur Dioxide Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’
T7 RNA Polymerase Competent Cell Buffers Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’
T7 DNA Polymerase T7 RNA Polymerase Purification Buffers
PURExpressKit (New England Biolabs) Phenol
XbaI (NEB) Chloroform
SpeI (NEB) 10x PFU Buffer
PstI (NEB) NTP
EcoRI (NEB) GMP
Dream Taq DNA Polymerase 10x Taq Buffer
Taq DNA Polymerase Ligase Buffer
RNAse A SDS-PAGE Reagents
TraB Urea PAGE reagents
iPPase Agarose
RNAse Inhibitor Agar
Tryptone
Yeast Extract
BioBasic Plasmid DNA miniprep Kit