Kristiturton (Talk | contribs) |
Kristiturton (Talk | contribs) |
||
Line 64: | Line 64: | ||
</style> | </style> | ||
− | <p><a href= | + | <p><a href="https://static.igem.org/mediawiki/2017/b/ba/LB_Media.pdf">LB Media</a></p> |
− | <p><a href=protocol">Agarose Gel Extraction</a></p> | + | <p><a href="protocol">Agarose Gel Extraction</a></p> |
<p><a href=protocol">PCR Amplification</a></p> | <p><a href=protocol">PCR Amplification</a></p> | ||
− | <p><a href=protocol">Colony PCR</a></p> | + | <p><a href="protocol">Colony PCR</a></p> |
− | <p><a href=protocol">DNA PUrification from Enzymatic Reactions</a></p> | + | <p><a href="protocol">DNA PUrification from Enzymatic Reactions</a></p> |
− | <p><a href=protocol">PCR product Purification</a></p> | + | <p><a href="protocol">PCR product Purification</a></p> |
− | <p><a href=protocol">In Vitro Transcription</a></p> | + | <p><a href="protocol">In Vitro Transcription</a></p> |
− | <p><a href=protocol">Ligations</a></p> | + | <p><a href="protocol">Ligations</a></p> |
− | <p><a href=protocol">Phenol/Chloroform Extraction and Ethanol Precipitation</a></p> | + | <p><a href="protocol">Phenol/Chloroform Extraction and Ethanol Precipitation</a></p> |
− | <p><a href=protocol">pJET Cloning</a></p> | + | <p><a href="protocol">pJET Cloning</a></p> |
− | <p><a href=protocol">Plasmid Miniprep</a></p> | + | <p><a href="protocol">Plasmid Miniprep</a></p> |
− | <p><a href=protocol">Preparation of Chemical Competent Cells</a></p> | + | <p><a href="protocol">Preparation of Chemical Competent Cells</a></p> |
− | <p><a href=protocol">Protein Overexpression</a></p> | + | <p><a href="protocol">Protein Overexpression</a></p> |
− | <p><a href=protocol">PURExpress NEB Kit</a></p> | + | <p><a href="protocol">PURExpress NEB Kit</a></p> |
− | <p><a href=protocol">Purification of Poly-Histidine Tagged Proteins</a></p> | + | <p><a href="protocol">Purification of Poly-Histidine Tagged Proteins</a></p> |
− | <p><a href=protocol">Restriction Enzyme Digest and Dephosphorylation</a></p> | + | <p><a href="protocol">Restriction Enzyme Digest and Dephosphorylation</a></p> |
− | <p><a href=protocol">T7- RNA Polymerase Purification</a></p> | + | <p><a href="protocol">T7- RNA Polymerase Purification</a></p> |
− | <p><a href=protocol">Transformation</a></p> | + | <p><a href="protocol">Transformation</a></p> |
<br><br><br><br> | <br><br><br><br> | ||
Line 212: | Line 212: | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
+ | <td>DNAseI</td> | ||
<td>Tryptone</td> | <td>Tryptone</td> | ||
− | |||
<td></td> | <td></td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
+ | <td></td> | ||
<td>Yeast Extract</td> | <td>Yeast Extract</td> | ||
− | + | <td></td> | |
− | + | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
− | |||
<td></td> | <td></td> | ||
+ | <td>TAKMz</td> | ||
+ | <td> </td> | ||
+ | </tr | ||
+ | <tr> | ||
<td></td> | <td></td> | ||
+ | <td>BioBasic Plasmid DNA miniprep Kit</td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td></td> | ||
+ | <td>Imidazole</td> | ||
+ | <td></td> | ||
+ | </TR> | ||
+ | |||
+ | |||
</table> | </table> | ||
</body> | </body> | ||
</html> | </html> |
Revision as of 15:19, 28 October 2017
Protocols
DNA PUrification from Enzymatic Reactions
Phenol/Chloroform Extraction and Ethanol Precipitation
Preparation of Chemical Competent Cells
Purification of Poly-Histidine Tagged Proteins
Restriction Enzyme Digest and Dephosphorylation
T7- RNA Polymerase Purification
Products/Reagents
td, th { border: 1px solid black; text-align: left; padding: 8px; } tr:nth-child(even) { background-color: white; }Enzymes | Buffers/Reagents | Other Products |
---|---|---|
Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
Phusion Polymerase Master Mix | Kanomycin/Chloramphenicol/Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | Dialyzation Membrane |
PURExpressKit (New England Biolabs) | Phenol | |
XbaI (NEB) | Chloroform | |
SpeI (NEB) | 10x PFU Buffer | |
PstI (NEB) | NTP | |
EcoRI (NEB) | GMP | |
Dream Taq DNA Polymerase | 10x Taq Buffer | |
Taq DNA Polymerase | Ligase Buffer | |
RNAse A | SDS-PAGE Reagents | |
TraB | Urea PAGE reagents | |
iPPase | Agarose | |
RNAse Inhibitor | Agar | |
DNAseI | Tryptone | |
Yeast Extract | ||
TAKMz | BioBasic Plasmid DNA miniprep Kit | |
Imidazole |