Difference between revisions of "Team:Lethbridge/Experiments"

Line 64: Line 64:
 
</style>
 
</style>
  
<p><a href=protocol">LB Media</a></p>  
+
<p><a href="https://static.igem.org/mediawiki/2017/b/ba/LB_Media.pdf">LB Media</a></p>  
  
<p><a href=protocol">Agarose Gel Extraction</a></p>  
+
<p><a href="protocol">Agarose Gel Extraction</a></p>  
  
 
<p><a href=protocol">PCR Amplification</a></p>  
 
<p><a href=protocol">PCR Amplification</a></p>  
  
<p><a href=protocol">Colony PCR</a></p>  
+
<p><a href="protocol">Colony PCR</a></p>  
  
<p><a href=protocol">DNA PUrification from Enzymatic Reactions</a></p>  
+
<p><a href="protocol">DNA PUrification from Enzymatic Reactions</a></p>  
  
<p><a href=protocol">PCR product Purification</a></p>  
+
<p><a href="protocol">PCR product Purification</a></p>  
  
<p><a href=protocol">In Vitro Transcription</a></p>  
+
<p><a href="protocol">In Vitro Transcription</a></p>  
  
<p><a href=protocol">Ligations</a></p>  
+
<p><a href="protocol">Ligations</a></p>  
  
<p><a href=protocol">Phenol/Chloroform Extraction and Ethanol Precipitation</a></p>  
+
<p><a href="protocol">Phenol/Chloroform Extraction and Ethanol Precipitation</a></p>  
  
<p><a href=protocol">pJET Cloning</a></p>  
+
<p><a href="protocol">pJET Cloning</a></p>  
  
<p><a href=protocol">Plasmid Miniprep</a></p>  
+
<p><a href="protocol">Plasmid Miniprep</a></p>  
  
<p><a href=protocol">Preparation of Chemical Competent Cells</a></p>  
+
<p><a href="protocol">Preparation of Chemical Competent Cells</a></p>  
  
<p><a href=protocol">Protein Overexpression</a></p>  
+
<p><a href="protocol">Protein Overexpression</a></p>  
  
<p><a href=protocol">PURExpress NEB Kit</a></p>  
+
<p><a href="protocol">PURExpress NEB Kit</a></p>  
  
<p><a href=protocol">Purification of Poly-Histidine Tagged Proteins</a></p>  
+
<p><a href="protocol">Purification of Poly-Histidine Tagged Proteins</a></p>  
  
<p><a href=protocol">Restriction Enzyme Digest and Dephosphorylation</a></p>  
+
<p><a href="protocol">Restriction Enzyme Digest and Dephosphorylation</a></p>  
  
<p><a href=protocol">T7- RNA Polymerase Purification</a></p>  
+
<p><a href="protocol">T7- RNA Polymerase Purification</a></p>  
  
<p><a href=protocol">Transformation</a></p>  
+
<p><a href="protocol">Transformation</a></p>  
 
   
 
   
 
<br><br><br><br>
 
<br><br><br><br>
Line 212: Line 212:
 
</tr>
 
</tr>
 
<tr>
 
<tr>
 +
    <td>DNAseI</td>
 
     <td>Tryptone</td>
 
     <td>Tryptone</td>
    <td>TAKM7</td>
 
 
     <td></td>
 
     <td></td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
 +
    <td></td>
 
     <td>Yeast Extract</td>
 
     <td>Yeast Extract</td>
     <td>Imidazole</td>
+
     <td></td>
  <td></td>
+
 
</tr>
 
</tr>
 
<tr>
 
<tr>
    <td>BioBasic Plasmid DNA miniprep Kit </td>
 
 
     <td></td>
 
     <td></td>
 +
    <td>TAKMz</td>
 +
    <td> </td>
 +
</tr
 +
<tr>
 
     <td></td>
 
     <td></td>
 +
    <td>BioBasic Plasmid DNA miniprep Kit</td>
 +
    <td></td>
 +
</tr>
 +
<tr>
 +
    <td></td>
 +
    <td>Imidazole</td>
 +
    <td></td>
 +
</TR>
 +
 
 +
 
</table>
 
</table>
  
 
</body>
 
</body>
 
</html>
 
</html>

Revision as of 15:19, 28 October 2017





Protocols

LB Media

Agarose Gel Extraction

PCR Amplification

Colony PCR

DNA PUrification from Enzymatic Reactions

PCR product Purification

In Vitro Transcription

Ligations

Phenol/Chloroform Extraction and Ethanol Precipitation

pJET Cloning

Plasmid Miniprep

Preparation of Chemical Competent Cells

Protein Overexpression

PURExpress NEB Kit

Purification of Poly-Histidine Tagged Proteins

Restriction Enzyme Digest and Dephosphorylation

T7- RNA Polymerase Purification

Transformation





Products/Reagents

td, th { border: 1px solid black; text-align: left; padding: 8px; } tr:nth-child(even) { background-color: white; }
Enzymes Buffers/Reagents Other Products
Shrimp Alkaline Phosphatase Affinity Chromatography Buffers Ni²+ Affinity Resin
DNA Blunting Enzyme IPTG Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’
Phusion Polymerase Master Mix Kanomycin/Chloramphenicol/Ampicillin Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’
PFU Polymerase Dimethyl Sulfur Dioxide Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’
T7 RNA Polymerase Competent Cell Buffers Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’
T7 DNA Polymerase T7 RNA Polymerase Purification Buffers Dialyzation Membrane
PURExpressKit (New England Biolabs) Phenol
XbaI (NEB) Chloroform
SpeI (NEB) 10x PFU Buffer
PstI (NEB) NTP
EcoRI (NEB) GMP
Dream Taq DNA Polymerase 10x Taq Buffer
Taq DNA Polymerase Ligase Buffer
RNAse A SDS-PAGE Reagents
TraB Urea PAGE reagents
iPPase Agarose
RNAse Inhibitor Agar
DNAseI Tryptone
Yeast Extract
TAKMz
BioBasic Plasmid DNA miniprep Kit
Imidazole