Kristiturton (Talk | contribs) |
Kristiturton (Talk | contribs) |
||
Line 36: | Line 36: | ||
<div class="centerContainer"> | <div class="centerContainer"> | ||
<h2 class="segmentHeader">Protocols</h2> | <h2 class="segmentHeader">Protocols</h2> | ||
+ | </div> | ||
<style> | <style> | ||
a:link { | a:link { | ||
Line 62: | Line 63: | ||
</style> | </style> | ||
+ | <div class="center"> | ||
<p><a href="https://static.igem.org/mediawiki/2017/b/ba/LB_Media.pdf">LB Media</a></p> | <p><a href="https://static.igem.org/mediawiki/2017/b/ba/LB_Media.pdf">LB Media</a></p> | ||
− | + | </div> | |
<p><a href="https://static.igem.org/mediawiki/2017/5/5f/Agarose_Gel_Extraction.pdf">Agarose Gel Extraction</a></p> | <p><a href="https://static.igem.org/mediawiki/2017/5/5f/Agarose_Gel_Extraction.pdf">Agarose Gel Extraction</a></p> | ||
Line 97: | Line 99: | ||
<p><a href="https://static.igem.org/mediawiki/2017/a/a6/Transformation.pdf">Transformation</a></p> | <p><a href="https://static.igem.org/mediawiki/2017/a/a6/Transformation.pdf">Transformation</a></p> | ||
+ | </div> | ||
<br><br><br><br> | <br><br><br><br> |
Revision as of 16:31, 28 October 2017
Protocols
DNA PUrification from Enzymatic Reactions
Phenol/Chloroform Extraction and Ethanol Precipitation
Preparation of Chemical Competent Cells
Purification of Poly-Histidine Tagged Proteins
Restriction Enzyme Digest and Dephosphorylation
Products/Reagents
Enzymes | Buffers/Reagents | Other Products |
---|---|---|
Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
Phusion Polymerase Master Mix | Kanomycin/Chloramphenicol/Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | Dialyzation Membrane |
PURExpressKit (New England Biolabs) | Phenol | |
XbaI (NEB) | Chloroform | |
SpeI (NEB) | 10x PFU Buffer | |
PstI (NEB) | NTP | |
EcoRI (NEB) | GMP | |
Dream Taq DNA Polymerase | 10x Taq Buffer | |
Taq DNA Polymerase | Ligase Buffer | |
RNAse A | SDS-PAGE Reagents | |
TraB | Urea PAGE reagents | |
iPPase | Agarose | |
RNAse Inhibitor | Agar | |
DNAseI | Tryptone | |
Yeast Extract | ||
TAKMz | BioBasic Plasmid DNA miniprep Kit | |
Imidazole |