Difference between revisions of "Team:Lethbridge/Experiments"
Kristiturton (Talk | contribs) |
Keithaiken (Talk | contribs) |
||
| Line 15: | Line 15: | ||
body {padding-top: 3.89em; font-family: Arial, sans-serif; background-color:#F2F2F2; color: black !important;} | body {padding-top: 3.89em; font-family: Arial, sans-serif; background-color:#F2F2F2; color: black !important;} | ||
.bannerImg {max-width: 100%; height:auto;} | .bannerImg {max-width: 100%; height:auto;} | ||
| + | #allContent {margin-left: 5%; margin-right: 5%} | ||
h1, h2 {text-align: center; color: black !important} | h1, h2 {text-align: center; color: black !important} | ||
h3 {font-style: oblique;} | h3 {font-style: oblique;} | ||
| Line 48: | Line 49: | ||
</head> | </head> | ||
<body> | <body> | ||
| − | <div><img src="https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png" class=" | + | <div><img src="https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png" class="bannerImg"></div> |
| + | <div id="allContent"> | ||
<br> | <br> | ||
| Line 234: | Line 236: | ||
<br> | <br> | ||
<br> | <br> | ||
| − | <img src="https://static.igem.org/mediawiki/2017/7/7d/Banner_footer_blank.png" class="bannerImg" | + | </div><!-- closing #allContent --> |
| + | <img src="https://static.igem.org/mediawiki/2017/7/7d/Banner_footer_blank.png" class="bannerImg"> | ||
</body> | </body> | ||
</html> | </html> | ||
Revision as of 02:02, 29 October 2017
Protocols
Products/Reagents
| Enzymes | Buffers/Reagents | Other Products |
|---|---|---|
| Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
| DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
| Phusion Polymerase Master Mix | Kanomycin / Chloramphenicol / Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
| PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
| T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
| T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | Dialyzation Membrane |
| PURExpressKit (New England Biolabs) | Phenol | |
| XbaI (NEB) | Chloroform | |
| SpeI (NEB) | 10x PFU Buffer | |
| PstI (NEB) | NTP | |
| EcoRI (NEB) | GMP | |
| Dream Taq DNA Polymerase | 10x Taq Buffer | |
| Taq DNA Polymerase | Ligase Buffer | |
| RNAse A | SDS-PAGE Reagents | |
| TraB | Urea PAGE reagents | |
| iPPase | Agarose | |
| RNAse Inhibitor | Agar | |
| DNAseI | Tryptone | |
| Yeast Extract | ||
| TAKMz | BioBasic Plasmid DNA miniprep Kit | |
| Imidazole |
