Difference between revisions of "Team:Lethbridge/Experiments"

Line 14: Line 14:
 
     /*#protocolTable th {width: 400px;}*/
 
     /*#protocolTable th {width: 400px;}*/
 
     #protocolTable th img {}
 
     #protocolTable th img {}
     #protocolTable tr {font-size: calc(8px + 1vw) !important; line-height: calc(1em + 0.5vw) !important; text-align: center !important; vertical-align: top;} /*width: 800px;*/
+
     #protocolTable tr {font-size: calc(8px + 0.5vw) !important; line-height: calc(1em + 0.5vw) !important; text-align: center !important; vertical-align: top;} /*width: 800px;*/
 
     #protocolTable td {align-content:center; padding: 15px;} /*width: 400px*/
 
     #protocolTable td {align-content:center; padding: 15px;} /*width: 400px*/
 
     #protocolTable tr:nth-child(even) {background-color: white;}
 
     #protocolTable tr:nth-child(even) {background-color: white;}

Revision as of 20:07, 29 October 2017


Protocols


Products/Reagents

Enzymes Buffers/Reagents Other Products
Shrimp Alkaline Phosphatase Affinity Chromatography Buffers Ni²+ Affinity Resin
DNA Blunting Enzyme IPTG Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’
Phusion Polymerase Master Mix Kanomycin / Chloramphenicol / Ampicillin Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’
PFU Polymerase Dimethyl Sulfur Dioxide Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’
T7 RNA Polymerase Competent Cell Buffers Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’
T7 DNA Polymerase T7 RNA Polymerase Purification Buffers Dialyzation Membrane
PURExpressKit (New England Biolabs) Phenol
XbaI (NEB) Chloroform
SpeI (NEB) 10x PFU Buffer
PstI (NEB) NTP
EcoRI (NEB) GMP
Dream Taq DNA Polymerase 10x Taq Buffer
Taq DNA Polymerase Ligase Buffer
RNAse A SDS-PAGE Reagents
TraB Urea PAGE reagents
iPPase Agarose
RNAse Inhibitor Agar
DNAseI Tryptone
Yeast Extract
TAKMz
BioBasic Plasmid DNA miniprep Kit
Imidazole