Difference between revisions of "Team:Lethbridge/Software"

Line 84: Line 84:
 
     <div class="col s12">
 
     <div class="col s12">
 
       <h1><span style="font-weight:normal;">One of these sequences is a toxin.</h1>
 
       <h1><span style="font-weight:normal;">One of these sequences is a toxin.</h1>
−
         <h1>Do you know which?</h1> <!-- Nice try buddy. Not that easy to find out. -->  
+
         <h1>Do you know which?</h1> <!-- Nice try buddy. Not that easy to find out. -->
−
     </div>  
+
     </div>
 
   </div>
 
   </div>
 
   <div class="row">
 
   <div class="row">
Line 98: Line 98:
 
     </div>
 
     </div>
 
     <div class="col s12 m6 l6">
 
     <div class="col s12 m6 l6">
−
       <p class="flow-text" style="word-wrap: break-word">AGGCACTTCCTACTTCTTAAGAAACGGCTAAGCAGCAGAGTTAAGAGCCTTAAGTCACTATCAAGCCCGCTAGTATTCAAACACAGCCACCTACTTCTACTTCTATCATGGCGGATGCTATTCAAGCGGAAGTTCAAAGTTTGCCGGCGGCTATTCAAGAGAAGCAGACCAAGACGGAAGAGCCGGCGGAAACACATG</p>
+
       <p class="flow-text" style="word-wrap: break-word">AGGCACTTCCTACTTCTTAAGAAACGGCTAAGCAGCAGAGTTAAGAGCCTTAAGTCACTATCAAGCCCGCTAGTATTCAAACACAGCCACCTACTTCTACTTCTATCATGGCGGATGCTATTCAAGCGGAAGTTCAAAGTTTGCCGGCGGCTATTCAAGAGAAGCAGACCAAGACGGAAGAGCCGGCGGAAACACATG</p>
 
     </div>
 
     </div>
−
   </div>
+
   </div>
 
</div>
 
</div>
  
Line 114: Line 114:
 
       <h5>Rapid Cell-Free Systems</h5>
 
       <h5>Rapid Cell-Free Systems</h5>
 
       <p class="flow-text">
 
       <p class="flow-text">
−
           In essence, our project is a rapidly purifiable cell-free system to bring the benefits of synthetic biology to as many people as possible. To do so, we provide methods to easily purify all of the necessary transcriptional and translational components. This includes proteins and RNAs- including functional tRNAs. Furthermore, the Next Vivo system lacks genomic DNA and is instead a minimal simple DNA input and protein output system. Because of these characteristics, Next vivo is highly amenable to genetic recoding.  
+
           In essence, our project is a rapidly purifiable cell-free system to bring the benefits of synthetic biology to as many people as possible. To do so, we provide methods to easily purify all of the necessary transcriptional and translational components. This includes proteins and RNAs- including functional tRNAs. Furthermore, the Next Vivo system lacks genomic DNA and is instead a minimal simple DNA input and protein output system. Because of these characteristics, Next vivo is highly amenable to genetic recoding.
 
         </p>
 
         </p>
 
       <p class="flow-text">
 
       <p class="flow-text">
Line 125: Line 125:
 
       <div class="col s12 m6">
 
       <div class="col s12 m6">
 
         <div align="center">
 
         <div align="center">
−
         <img class="responsive-img" style="max-height:300px"src="https://static.igem.org/mediawiki/2017/d/d6/T--Lethbridge--cellfreepic.png" />
+
         <img class="responsive-img" style="max-height:300px"src="https://static.igem.org/mediawiki/2017/d/d6/T--Lethbridge--cellfreepic.png" />
 
         </div>
 
         </div>
−
       </div>  
+
       </div>
−
     </div>  
+
     </div>
 
     <div class="row">
 
     <div class="row">
 
       <div class="col s12 m6">
 
       <div class="col s12 m6">
 
         <h5>Genetic Recoding</h5>
 
         <h5>Genetic Recoding</h5>
 
         <p class="flow-text">
 
         <p class="flow-text">
−
           Genetic recoding is a process by which the conventional relationships between codon-anticodon and tRNA-amino acid are altered. For instance, the amber stop codon (UAG) can be reassigned to instead incorporate a natural or unnatural amino acid into a growing peptide. CITATION  
+
           Genetic recoding is a process by which the conventional relationships between codon-anticodon and tRNA-amino acid are altered. For instance, the amber stop codon (UAG) can be reassigned to instead incorporate a natural or unnatural amino acid into a growing peptide. CITATION
 
           <blockquote class="grey lighten-2">
 
           <blockquote class="grey lighten-2">
 
             Modifying the relationship between codon and amino acid incorporation is equivalent to the creation of a novel genetic code.
 
             Modifying the relationship between codon and amino acid incorporation is equivalent to the creation of a novel genetic code.
Line 154: Line 154:
 
         </div>
 
         </div>
 
       </div>
 
       </div>
−
   </div>
+
   </div>
 
   <div class="row">
 
   <div class="row">
 
     <div class="col s12 m6 l4">
 
     <div class="col s12 m6 l4">
Line 182: Line 182:
 
           </div>
 
           </div>
 
       </div>
 
       </div>
−
     </div>
+
     </div>
 
   </div>
 
   </div>
 
</div>
 
</div>
  
−
<div class="container">
+
<div class="container">
 
   <div class="row">
 
   <div class="row">
−
     <div class="col s12">  
+
    <div class="col s12">
 +
      <h1 class="segmentHeader"><span style="font-weight:normal;">ENCRYPTED SEQUENCES</h1>
 +
    </div>
 +
  </div>
 +
  <div class="row">
 +
     <div class="col s12">
 
       <h5>Novel Genetic Codes</h5>
 
       <h5>Novel Genetic Codes</h5>
 
       <p class="flow-text">
 
       <p class="flow-text">
−
         Though this is a developing field, genetic recoding will only develop as scientific understanding and computational design improve. It is not hard to imagine the construction of a library of tRNAs that can be charged with non-canonical amino acids. Whether this is achieved via flexizymes or mutant pairs, selecting internally consistent sets of tRNAs and charging machinery will make it trivially easy to design a novel genetic code, and the Next vivo system would make it readily obtainable.
+
         Though this is a developing field, genetic recoding will only develop as scientific understanding and computational design improve. It is not hard to imagine the construction of a library of tRNAs that can be charged with non-canonical amino acids. Whether this is achieved via flexizymes or mutant pairs, selecting internally consistent sets of tRNAs and charging machinery will make it trivially easy to design a novel genetic code, and the Next vivo system would make it readily obtainable.
 
       </p>
 
       </p>
 
       <blockquote class="grey lighten-2">
 
       <blockquote class="grey lighten-2">
Line 203: Line 208:
 
       </div>
 
       </div>
 
       <p class="flow-text">
 
       <p class="flow-text">
−
         <br />Where n is the number of nucleic acid bases, l is the length of the codon, s is the number of switches, and a is the number of amino acids that need a codon. At a minimum, a single switch means that there are 64 potential internally consistent genetic codes available.  
+
         <br />Where n is the number of nucleic acid bases, l is the length of the codon, s is the number of switches, and a is the number of amino acids that need a codon. At a minimum, a single switch means that there are 64 potential internally consistent genetic codes available.
 
       </p>
 
       </p>
 
         <blockquote class="grey lighten-2">
 
         <blockquote class="grey lighten-2">
−
           When all codons are reassigned, a simplistic estimation (64!/20!) suggests that there are <b>5.21 x 10^70</b> possible combinations available.  
+
           When all codons are reassigned, a simplistic estimation (64!/20!) suggests that there are <b>5.21 x 10^70</b> possible combinations available.
 
         </blockquote>
 
         </blockquote>
 
       <p>
 
       <p>
−
         This is an extremely large sample space to search combinatorially. The number of possible genetic codes approaches the number of atoms in the universe. However, it remains to be seen whether or not this relationship is cryptographically strong.  
+
         This is an extremely large sample space to search combinatorially. The number of possible genetic codes approaches the number of atoms in the universe. However, it remains to be seen whether or not this relationship is cryptographically strong.
 
       </p>
 
       </p>
 
     </div>
 
     </div>
 
     <div class="row">
 
     <div class="row">
−
       <div class="col s12 m4">  
+
       <div class="col s12 m4">
 
         <h5>Preliminary Testing</h5>
 
         <h5>Preliminary Testing</h5>
 
         <p class="flow-text">
 
         <p class="flow-text">
−
           The potential for harm as a result of this technology is not to be underestimated. If recoded systems become as prevalent and easy to obtain as we expect them to be, control over where toxin sequences are sent greatly diminishes. Accordingly, we reached out to gene synthesis companies to determine whether or not current bioinformatic technologies can detect radically re-coded toxin sequences.  
+
           The potential for harm as a result of this technology is not to be underestimated. If recoded systems become as prevalent and easy to obtain as we expect them to be, control over where toxin sequences are sent greatly diminishes. Accordingly, we reached out to gene synthesis companies to determine whether or not current bioinformatic technologies can detect radically re-coded toxin sequences.
 
         </p>
 
         </p>
 
         <p class="flow-text">
 
         <p class="flow-text">
Line 228: Line 233:
 
         <h5>Detecting Encrypted Sequences</h5>
 
         <h5>Detecting Encrypted Sequences</h5>
 
         <p class="flow-text">
 
         <p class="flow-text">
−
           A total of five companies from the IGSC (n=5) of the 11 possible agreed to test our sequences. Two control sequences were sent along with the encrypted sequences: unencrypted GFP and unencrypted conotoxin. The remaining 10 sequences consisted of equal numbers of encrypted GFP and conotoxin. Because BLAST relies on the Universal Genetic Code, not company was able to detect the encrypted sequences.  
+
           A total of five companies from the IGSC (n=5) of the 11 possible agreed to test our sequences. Two control sequences were sent along with the encrypted sequences: unencrypted GFP and unencrypted conotoxin. The remaining 10 sequences consisted of equal numbers of encrypted GFP and conotoxin. Because BLAST relies on the Universal Genetic Code, not company was able to detect the encrypted sequences.
 
         </p>
 
         </p>
 
         <table class="">
 
         <table class="">
Line 250: Line 255:
 
             <td><b>Identification Rate</b></td>
 
             <td><b>Identification Rate</b></td>
 
             <td>100% (&#177;0%)</td>
 
             <td>100% (&#177;0%)</td>
−
             <td>0% (&#177;0%)</td>
+
             <td>100% (&#177;0%)</td>
 
             <td>0% (&#177;0%)</td>
 
             <td>0% (&#177;0%)</td>
 
             <td>0% (&#177;0%)</td>
 
             <td>0% (&#177;0%)</td>
Line 264: Line 269:
 
         </p>
 
         </p>
 
         <p class="flow-text">
 
         <p class="flow-text">
−
           Following the initial testing, we have maintained correspondence with individuals at these companies are are looking forward to working closely with them to ensure that DNA synthesis remains a safe and secure practice. We would also like to thank them for their tremendous assistance in identifying and dealing with this problem before it becomes a pressing security issue. Synthetic biologists need DNA, and DNA synthesis needs new bioinformatic screening tools.  
+
           Following the initial testing, we have maintained correspondence with individuals at these companies are are looking forward to working closely with them to ensure that DNA synthesis remains a safe and secure practice. We would also like to thank them for their tremendous assistance in identifying and dealing with this problem before it becomes a pressing security issue. Synthetic biologists need DNA, and DNA synthesis needs new bioinformatic screening tools.
 
         </p>
 
         </p>
 
       </div>
 
       </div>
Line 277: Line 282:
 
     </div>
 
     </div>
 
   </div>
 
   </div>
−
   <div class="row">  
+
   <div class="row">
 
     <div class="col s12 m6">
 
     <div class="col s12 m6">
 
       <h5>Basic Local Alignment Search Tool</h5>
 
       <h5>Basic Local Alignment Search Tool</h5>
 
       <p>
 
       <p>
−
         Currently the only tool maintaining the safety and security of DNA synthesis is BLAST.  We have shown earlier that recoding completely nullifies the ability of BLAST to detect a sequence, but it remains to be seen how much recording BLAST can tolerate before a sequence becomes totally unmatchable to a reference. BLAST works by breaking a query sequence into small ‘words’ of a specified length. Words that exactly match a sequence within the database are ‘high-scoring pairs’ and contribute to a positive scoring alignment. In essence, the more exact word matches in a query sequence to a database sequence, the better the alignment score will be.  
+
         Currently the only tool maintaining the safety and security of DNA synthesis is BLAST.  We have shown earlier that recoding completely nullifies the ability of BLAST to detect a sequence, but it remains to be seen how much recording BLAST can tolerate before a sequence becomes totally unmatchable to a reference. BLAST works by breaking a query sequence into small ‘words’ of a specified length. Words that exactly match a sequence within the database are ‘high-scoring pairs’ and contribute to a positive scoring alignment. In essence, the more exact word matches in a query sequence to a database sequence, the better the alignment score will be.
 
       </p>
 
       </p>
 
     </div>
 
     </div>
−
     <div class="col s12 m6">  
+
     <div class="col s12 m6">
 
       <h5>How BLAST Works</h5>
 
       <h5>How BLAST Works</h5>
 
       <img class="responsive-img" src="https://image.slidesharecdn.com/ncbifinal-111218021720-phpapp01/95/ncbi-45-728.jpg?cb=1413844083" />
 
       <img class="responsive-img" src="https://image.slidesharecdn.com/ncbifinal-111218021720-phpapp01/95/ncbi-45-728.jpg?cb=1413844083" />
−
     </div>
+
     </div>
 
   </div>
 
   </div>
 
   <div class="row">
 
   <div class="row">
 
     <div class="col s12">
 
     <div class="col s12">
 
       <p>
 
       <p>
−
         However, it is not intuitively obvious what degree of genetic recoding is required to evade detection via BLAST. To test this, we developed a software tool, <b>CODONxCHANGE</b>, written in Python 2.7 to test the integrity of the BLAST platform against sequences that have been partially encrypted with a set number of recoding events. This tool can also be used prepare genes for implementation in an orthogonal cell-free system for biocontainment purposes.  
+
         However, it is not intuitively obvious what degree of genetic recoding is required to evade detection via BLAST. To test this, we developed a software tool, <b>CODONxCHANGE</b>, written in Python 2.7 to test the integrity of the BLAST platform against sequences that have been partially encrypted with a set number of recoding events. This tool can also be used prepare genes for implementation in an orthogonal cell-free system for biocontainment purposes.
 
       </p>
 
       </p>
 
     </div>
 
     </div>
Line 300: Line 305:
 
       <h5>CODONxCHANGE</h5>
 
       <h5>CODONxCHANGE</h5>
 
       <p>
 
       <p>
−
         The tool is designed to take a nucleic acid coding sequence or protein sequence as an input, and return an ‘encrypted’ version of the sequence. It achieves this by translating a DNA sequence into a protein sequence, and then sequentially assigning a random codon to each unique amino acid required within the protein. The resultant sequence is returned in a newly encrypted state.  
+
         The tool is designed to take a nucleic acid coding sequence or protein sequence as an input, and return an ‘encrypted’ version of the sequence. It achieves this by translating a DNA sequence into a protein sequence, and then sequentially assigning a random codon to each unique amino acid required within the protein. The resultant sequence is returned in a newly encrypted state.
 
       </p>
 
       </p>
 
     </div>
 
     </div>
Line 311: Line 316:
 
           <a href="https://github.com/chrisaac/CODONxCHANGE" class="align-center">Check out <b>CODONxCHANGE</b> on Github!</a>
 
           <a href="https://github.com/chrisaac/CODONxCHANGE" class="align-center">Check out <b>CODONxCHANGE</b> on Github!</a>
 
         </div>
 
         </div>
−
       </div>
+
       </div>
 
     </div>
 
     </div>
 
   </div>
 
   </div>
Line 358: Line 363:
 
   </div>
 
   </div>
 
   <div class="row">
 
   <div class="row">
−
     <div class="col s12 m4">
+
     <div class="col s12 m6">
 
       <h5>Changes on the Horizon</h5>
 
       <h5>Changes on the Horizon</h5>
 
       <p class="flowText">
 
       <p class="flowText">
−
         Though the power of the BLAST program to detect genetically recoded sequences has been shown to be incredibly limited, there are initiatives to develop new biosecurity tools. Intelligence Advanced Research Projects Activity (IARPA), the cousin of DARPA, has a program called Functional Genomic and Computational Assessment of Threats (Fun GCAT) which aims to catalyze the development of tools to improve DNA screening capabilites. Several of the synthesis companies that we spoke to are involved in this program.  
+
         Though the power of the BLAST program to detect genetically recoded sequences has been shown to be incredibly limited, there are initiatives to develop new biosecurity tools. Intelligence Advanced Research Projects Activity (IARPA), the cousin of DARPA, has a program called Functional Genomic and Computational Assessment of Threats (Fun GCAT) which aims to catalyze the development of tools to improve DNA screening capabilites. Several of the synthesis companies that we spoke to are involved in this program.
 
       </p>
 
       </p>
 
     </div>
 
     </div>
−
     <div class="col s12 m4">
+
     <div class="col s12 m3">
 
       <div class="card blue-grey darken-3">
 
       <div class="card blue-grey darken-3">
 
         <div class="card-content white-text">
 
         <div class="card-content white-text">
Line 374: Line 379:
 
     </div>
 
     </div>
 
   </div>
 
   </div>
−
   <div class="col s12 m4">
+
   <div class="col s12 m3">
 
     <div class="card purple darken-3">
 
     <div class="card purple darken-3">
 
       <div class="card-content white-text">
 
       <div class="card-content white-text">

Revision as of 22:43, 29 October 2017



One of these sequences is a toxin.

Do you know which?

ACAGTTACACGGACAACAAGGTGTTCCAGGCTTCTTTCCTCCCTTCGACGATGTATTTCCAATAGGTGTAATCGTCGGCGAAATCGTGTTCGGTTCTCCCGACGACTGCGAAGGAAACGGATTGTTCGGTGTATTCGGCGTGTACAGCAGAATTTCACCCGACAGCGGTCCTTCTTCACCAAATCCCAGCGGCGGCGG

CTGCGCGATGCTCGACGAGTCAATTCCGCTGTAGTACAGGAAGTCGTACGAGTCATTGCTATTGTATCAGCTAGAGATAATCGCGTACGCGCTCGAGCTCGAGCTATTTCGTCCTGAGCTGATGTCTCCGTCGATAATGAAAAATCCTCCGCTGATGTCCAGGTACAGACCCAGTCCGTCGTATCCTCCAATCGCTGA

GGTGCGAAGATTGACGACCCGCTCTATATTCATCATGTGTGGCCGCATGACCCGACAATTACACATTTCATTTTAAAGCTCGCGCATGCGATTGACATTGACATTACACTATATGAAATTAAGCCGTATCCGAAGCTCTGGCGTTATTATATTAAGCCGGTGCATGTGTCTGTGTATCCGCATTATTATCTCGCGGAA

AGGCACTTCCTACTTCTTAAGAAACGGCTAAGCAGCAGAGTTAAGAGCCTTAAGTCACTATCAAGCCCGCTAGTATTCAAACACAGCCACCTACTTCTACTTCTATCATGGCGGATGCTATTCAAGCGGAAGTTCAAAGTTTGCCGGCGGCTATTCAAGAGAAGCAGACCAAGACGGAAGAGCCGGCGGAAACACATG

THE NEXT VIVO CONNECTION

Rapid Cell-Free Systems

In essence, our project is a rapidly purifiable cell-free system to bring the benefits of synthetic biology to as many people as possible. To do so, we provide methods to easily purify all of the necessary transcriptional and translational components. This includes proteins and RNAs- including functional tRNAs. Furthermore, the Next Vivo system lacks genomic DNA and is instead a minimal simple DNA input and protein output system. Because of these characteristics, Next vivo is highly amenable to genetic recoding.

For a more comprehensive look at the system, check out our design page.

Genetic Recoding

Genetic recoding is a process by which the conventional relationships between codon-anticodon and tRNA-amino acid are altered. For instance, the amber stop codon (UAG) can be reassigned to instead incorporate a natural or unnatural amino acid into a growing peptide. CITATION

Modifying the relationship between codon and amino acid incorporation is equivalent to the creation of a novel genetic code.
This has numerous benefits including the incorporation of unnatural amino acids, biocontainment, and protein engineering.

Genetic Recoding vs. Codon Reassignment

Though there is some discussion surrounding the use of the term “Genetic Recoding” and “Codon Reassignment.” Becuase our system falls in between two proposed definitions, we have chosen to refer to the practice as “Genetic Recoding” in the context of our project and will refer to it accordingly.

The Distinction Between Recoding and Codon Reassignment
Recoding can be accomplished via:
  • Introducing orthogonal tRNA-aaRS pairs CITATION
  • Mutating tRNA-aaRS pairs CITATION
  • tRNA misacylation by promiscuous RNA enzymes (Flexizymes) CITATION

Other iGEM Teams are also working on codon reassignment for alternative purposes. Check out the awesome project at Bielefeld where they focus on expanding the genetic code!

Bielefeld-CeBiTec

ENCRYPTED SEQUENCES

Novel Genetic Codes

Though this is a developing field, genetic recoding will only develop as scientific understanding and computational design improve. It is not hard to imagine the construction of a library of tRNAs that can be charged with non-canonical amino acids. Whether this is achieved via flexizymes or mutant pairs, selecting internally consistent sets of tRNAs and charging machinery will make it trivially easy to design a novel genetic code, and the Next vivo system would make it readily obtainable.

The apparent risk of this technology is that genetic recoding may allow harmful sequences to be “encrypted”, thus masking the information contained within while retaining the ability to faithfully produce the encoded protein.

When the available sample space provided by the genetic code is analyzed, recoding allows for a potential to generate numerous genetic codes according to the following formula:


Where n is the number of nucleic acid bases, l is the length of the codon, s is the number of switches, and a is the number of amino acids that need a codon. At a minimum, a single switch means that there are 64 potential internally consistent genetic codes available.

When all codons are reassigned, a simplistic estimation (64!/20!) suggests that there are 5.21 x 10^70 possible combinations available.

This is an extremely large sample space to search combinatorially. The number of possible genetic codes approaches the number of atoms in the universe. However, it remains to be seen whether or not this relationship is cryptographically strong.

Preliminary Testing

The potential for harm as a result of this technology is not to be underestimated. If recoded systems become as prevalent and easy to obtain as we expect them to be, control over where toxin sequences are sent greatly diminishes. Accordingly, we reached out to gene synthesis companies to determine whether or not current bioinformatic technologies can detect radically re-coded toxin sequences.

Emails were sent to all current members of the IGSC asking them to screen twelve sequences for us. Of the five companies that were willing to help us, all of them correctly identified the un-encrypted toxic proteins. However, no organization could correctly identify the encrypted toxins. The data is available to try for yourself.

Detecting Encrypted Sequences

A total of five companies from the IGSC (n=5) of the 11 possible agreed to test our sequences. Two control sequences were sent along with the encrypted sequences: unencrypted GFP and unencrypted conotoxin. The remaining 10 sequences consisted of equal numbers of encrypted GFP and conotoxin. Because BLAST relies on the Universal Genetic Code, not company was able to detect the encrypted sequences.

Unencrypted Sequences (n=2) Encrypted Sequences (n=10)
Sequence Identity Green Flourescent Protein (n=1) Conotoxin (n=1) Green Flourescent Protein (n=5) Conotoxin (n=5)
Identification Rate 100% (±0%) 100% (±0%) 0% (±0%) 0% (±0%)

This experiment was repeated using each variation of the BLAST software hosted on the NCBI website. Again, the software could not identify any of the completely recoded sequences.

Following the initial testing, we have maintained correspondence with individuals at these companies are are looking forward to working closely with them to ensure that DNA synthesis remains a safe and secure practice. We would also like to thank them for their tremendous assistance in identifying and dealing with this problem before it becomes a pressing security issue. Synthetic biologists need DNA, and DNA synthesis needs new bioinformatic screening tools.

BEATING BLAST

Basic Local Alignment Search Tool

Currently the only tool maintaining the safety and security of DNA synthesis is BLAST. We have shown earlier that recoding completely nullifies the ability of BLAST to detect a sequence, but it remains to be seen how much recording BLAST can tolerate before a sequence becomes totally unmatchable to a reference. BLAST works by breaking a query sequence into small ‘words’ of a specified length. Words that exactly match a sequence within the database are ‘high-scoring pairs’ and contribute to a positive scoring alignment. In essence, the more exact word matches in a query sequence to a database sequence, the better the alignment score will be.

How BLAST Works

However, it is not intuitively obvious what degree of genetic recoding is required to evade detection via BLAST. To test this, we developed a software tool, CODONxCHANGE, written in Python 2.7 to test the integrity of the BLAST platform against sequences that have been partially encrypted with a set number of recoding events. This tool can also be used prepare genes for implementation in an orthogonal cell-free system for biocontainment purposes.

CODONxCHANGE

The tool is designed to take a nucleic acid coding sequence or protein sequence as an input, and return an ‘encrypted’ version of the sequence. It achieves this by translating a DNA sequence into a protein sequence, and then sequentially assigning a random codon to each unique amino acid required within the protein. The resultant sequence is returned in a newly encrypted state.

Check out CODONxCHANGE on Github!
How robust is BLAST?
Name Item Name Item Price
Alvin Eclair $0.87
Alan Jellybean $3.76
Jonathan Lollipop $7.00

The results of this analysis suggests that the most effective number of switches to BEAT Blast is X. More results can be found on the GITHUB PAGE.

BUILDING SOLUTIONS

Changes on the Horizon

Though the power of the BLAST program to detect genetically recoded sequences has been shown to be incredibly limited, there are initiatives to develop new biosecurity tools. Intelligence Advanced Research Projects Activity (IARPA), the cousin of DARPA, has a program called Functional Genomic and Computational Assessment of Threats (Fun GCAT) which aims to catalyze the development of tools to improve DNA screening capabilites. Several of the synthesis companies that we spoke to are involved in this program.

Check out IARPA!
Check out FunGCAT!