Kristiturton (Talk | contribs) |
Kristiturton (Talk | contribs) |
||
Line 154: | Line 154: | ||
<td>T7 DNA Polymerase</td> | <td>T7 DNA Polymerase</td> | ||
<td>T7 RNA Polymerase Purification Buffers</td> | <td>T7 RNA Polymerase Purification Buffers</td> | ||
− | <td></td> | + | <td>Dialyzation Membrane</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Line 213: | Line 213: | ||
<tr> | <tr> | ||
<td>Tryptone</td> | <td>Tryptone</td> | ||
− | <td></td> | + | <td>TAKM7</td> |
<td></td> | <td></td> | ||
</tr> | </tr> |
Revision as of 14:29, 28 October 2017
Protocols
DNA PUrification from Enzymatic Reactions
Phenol/Chloroform Extraction and Ethanol Precipitation
Preparation of Chemical Competent Cells
Purification of Poly-Histidine Tagged Proteins
Restriction Enzyme Digest and Dephosphorylation
T7- RNA Polymerase Purification
Products/Reagents
td, th { border: 1px solid black; text-align: left; padding: 8px; } tr:nth-child(even) { background-color: white; }Enzymes | Buffers/Reagents | Other Products |
---|---|---|
Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
Phusion Polymerase Master Mix | Kanomycin/Chloramphenicol/Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | Dialyzation Membrane |
PURExpressKit (New England Biolabs) | Phenol | |
XbaI (NEB) | Chloroform | |
SpeI (NEB) | 10x PFU Buffer | |
PstI (NEB) | NTP | |
EcoRI (NEB) | GMP | |
Dream Taq DNA Polymerase | 10x Taq Buffer | |
Taq DNA Polymerase | Ligase Buffer | |
RNAse A | SDS-PAGE Reagents | |
TraB | Urea PAGE reagents | |
iPPase | Agarose | |
RNAse Inhibitor | Agar | |
Tryptone | TAKM7 | |
Yeast Extract | ||
BioBasic Plasmid DNA miniprep Kit |