Kristiturton (Talk | contribs) |
Keithaiken (Talk | contribs) |
||
Line 26: | Line 26: | ||
.segmentContainer p.segment2 {font-size: calc(22px + 0.5vw) !important; line-height: calc(1.1em + 0.5vw) !important;} | .segmentContainer p.segment2 {font-size: calc(22px + 0.5vw) !important; line-height: calc(1.1em + 0.5vw) !important;} | ||
.contentDiv {display: inline-block; vertical-align: middle;} | .contentDiv {display: inline-block; vertical-align: middle;} | ||
+ | |||
+ | a:link {color: Blue; background-color: transparent; text-decoration: none;} | ||
+ | a:visited {color: red; background-color: transparent; text-decoration: none;} | ||
+ | a:hover {color: red; background-color: transparent; text-decoration: underline;} | ||
+ | a:active {color: yellow; background-color: transparent; text-decoration: underline;} | ||
+ | |||
+ | td, th {border: 1px solid black; text-align: center; padding: 8px;} | ||
+ | tr:nth-child(even) {background-color: white;} | ||
</style> | </style> | ||
</head> | </head> | ||
<body> | <body> | ||
<div><img src="https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png" class="center fit"></div> | <div><img src="https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png" class="center fit"></div> | ||
− | |||
<br><br><br><br> | <br><br><br><br> | ||
Line 37: | Line 44: | ||
<h2 class="segmentHeader">Protocols</h2> | <h2 class="segmentHeader">Protocols</h2> | ||
</div> | </div> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
<div class="center"> | <div class="center"> | ||
Line 106: | Line 88: | ||
<div class="centerContainer"> | <div class="centerContainer"> | ||
<h2 class="segmentHeader">Products/Reagents</h2> | <h2 class="segmentHeader">Products/Reagents</h2> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
<table> | <table> | ||
Line 236: | Line 205: | ||
<td>Imidazole</td> | <td>Imidazole</td> | ||
<td></td> | <td></td> | ||
− | </ | + | </tr> |
− | + | ||
− | + | ||
</table> | </table> | ||
</body> | </body> | ||
</html> | </html> |
Revision as of 16:40, 28 October 2017
![](https://static.igem.org/mediawiki/2017/f/f4/Banner_LAexperiments.png)
Protocols
DNA PUrification from Enzymatic Reactions
Phenol/Chloroform Extraction and Ethanol Precipitation
Preparation of Chemical Competent Cells
Purification of Poly-Histidine Tagged Proteins
Restriction Enzyme Digest and Dephosphorylation
Products/Reagents
Enzymes | Buffers/Reagents | Other Products |
---|---|---|
Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
Phusion Polymerase Master Mix | Kanomycin/Chloramphenicol/Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | Dialyzation Membrane |
PURExpressKit (New England Biolabs) | Phenol | |
XbaI (NEB) | Chloroform | |
SpeI (NEB) | 10x PFU Buffer | |
PstI (NEB) | NTP | |
EcoRI (NEB) | GMP | |
Dream Taq DNA Polymerase | 10x Taq Buffer | |
Taq DNA Polymerase | Ligase Buffer | |
RNAse A | SDS-PAGE Reagents | |
TraB | Urea PAGE reagents | |
iPPase | Agarose | |
RNAse Inhibitor | Agar | |
DNAseI | Tryptone | |
Yeast Extract | ||
TAKMz | BioBasic Plasmid DNA miniprep Kit | |
Imidazole |