Difference between revisions of "Team:Lethbridge/Experiments"
Keithaiken (Talk | contribs) |
Keithaiken (Talk | contribs) |
||
| Line 74: | Line 74: | ||
<tr> | <tr> | ||
<th style="background-color: #377b7e; color: #ffffff; font-weight: bold;">Enzymes</th> | <th style="background-color: #377b7e; color: #ffffff; font-weight: bold;">Enzymes</th> | ||
| − | <th>Buffers/Reagents</th> | + | <th style="background-color: #377b7e; color: #ffffff; font-weight: bold;">Buffers/Reagents</th> |
| − | <th>Other Products</th> | + | <th style="background-color: #377b7e; color: #ffffff; font-weight: bold;">Other Products</th> |
</tr> | </tr> | ||
<tr> | <tr> | ||
Revision as of 16:53, 28 October 2017
Protocols
Products/Reagents
| Enzymes | Buffers/Reagents | Other Products |
|---|---|---|
| Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
| DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
| Phusion Polymerase Master Mix | Kanomycin/Chloramphenicol/Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
| PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
| T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
| T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | Dialyzation Membrane |
| PURExpressKit (New England Biolabs) | Phenol | |
| XbaI (NEB) | Chloroform | |
| SpeI (NEB) | 10x PFU Buffer | |
| PstI (NEB) | NTP | |
| EcoRI (NEB) | GMP | |
| Dream Taq DNA Polymerase | 10x Taq Buffer | |
| Taq DNA Polymerase | Ligase Buffer | |
| RNAse A | SDS-PAGE Reagents | |
| TraB | Urea PAGE reagents | |
| iPPase | Agarose | |
| RNAse Inhibitor | Agar | |
| DNAseI | Tryptone | |
| Yeast Extract | ||
| TAKMz | BioBasic Plasmid DNA miniprep Kit | |
| Imidazole |
