Difference between revisions of "Team:Lethbridge/Software"

Line 29: Line 29:
 
</head>
 
</head>
 
<body>
 
<body>
−
<div><img src="https://static.igem.org/mediawiki/2017/5/51/Banner_PRdemonstrate.png"  class="center fit"></div>
+
<div><img src="https://static.igem.org/mediawiki/2017/4/4d/Banner_HPsoftware.png"  class="center fit"></div>
  
 
<br><br>
 
<br><br>
  
 
<h1><span style="font-weight:normal;">One of these sequences is a toxin.</h1>
 
<h1><span style="font-weight:normal;">One of these sequences is a toxin.</h1>
−
  <h1>Do you know which?</h1>
+
<h1>Do you know which?</h1>
  
−
<p class="pageText">One of the key features of Next vivo is the ability purify all the components in a single step purification. As a proof of concept we expressed four of the TX-TL components and co-purified them all using a nickel sepharose chromatography column (see figure below). The four proteins used in this initial test were selected based on their molecular weights relative to each other for visualization purposes. </p>
+
<p>ACAGTTACACGGACAACAAGGTGTTCCAGGCTTCTTTCCTCCCTTCGACGATGTATTTCCAATAGGTGTAATCGTCGGCGAAATCGTGTTCGGTTCTCCCGACGACTGCGAAGGAAACGGATTGTTCGGTGTATTCGGCGTGTACAGCAGAATTTCACCCGACAGCGGTCCTTCTTCACCAAATCCCAGCGGCGGCGG</p>
 +
<p>CTGCGCGATGCTCGACGAGTCAATTCCGCTGTAGTACAGGAAGTCGTACGAGTCATTGCTATTGTATCAGCTAGAGATAATCGCGTACGCGCTCGAGCTCGAGCTATTTCGTCCTGAGCTGATGTCTCCGTCGATAATGAAAAATCCTCCGCTGATGTCCAGGTACAGACCCAGTCCGTCGTATCCTCCAATCGCTGA</p>
 +
<p>GGTGCGAAGATTGACGACCCGCTCTATATTCATCATGTGTGGCCGCATGACCCGACAATTACACATTTCATTTTAAAGCTCGCGCATGCGATTGACATTGACATTACACTATATGAAATTAAGCCGTATCCGAAGCTCTGGCGTTATTATATTAAGCCGGTGCATGTGTCTGTGTATCCGCATTATTATCTCGCGGAA</p>
 +
<p>AGGCACTTCCTACTTCTTAAGAAACGGCTAAGCAGCAGAGTTAAGAGCCTTAAGTCACTATCAAGCCCGCTAGTATTCAAACACAGCCACCTACTTCTACTTCTATCATGGCGGATGCTATTCAAGCGGAAGTTCAAAGTTTGCCGGCGGCTATTCAAGAGAAGCAGACCAAGACGGAAGAGCCGGCGGAAACACATG</p>
 +
<!-- Nice try buddy. It's not that easy to find out. -->  
  
−
<img style="float:center; margin-left:20px; margin-right:60px; margin-top:30px; width:  ; height: 330px;" src="https://static.igem.org/mediawiki/2017/d/d6/T--Lethbridge--cellfreepic.png" class="img-responsive">
+
<h2> V </h2>
  
−
<p class="pageText">Figure 1 - Representative overexpression and multiprotein purification of TX-TL components. Each TX-TL component was expressed from E. coli cells carrying the plasmid encoding the specified component and samples three hours post induction were collected (Lane 2-5). The expressing cells of each component were pooled and lysed before applying the lysate to a nickel-sepharose affinity column for isolation of just the polyhistidine tagged TX-TL components. After washing away the unwanted cellular proteins and debris, the TX-TL components were eluted from the Nickel-sepharose to a high level of purity (Lane 6). </p>
+
<h1 class="segmentHeader"><span style="font-weight:normal;">The Next vivo Connection</h1>
−
 
+
−
 
+
−
<p class="pageText">From this initial test we have confidence that scaling the multi-protein purification up to include all, or large groups of, the TX-TL proteins will be feasible. The overexpression and purification of these four proteins was done with minimal lab equipment and supplies.
+
−
</p>
+
−
 
+
−
            <h1 class="segmentHeader"><span style="font-weight:normal;">Validation Construct</h1>
+
  
 
<p class="pageText">As an additional tool outside the Next vivo system, we developed a construct that can be used to measure the amount of transcription, translation, or both! The details of this construct can be found on the design page (link).  
 
<p class="pageText">As an additional tool outside the Next vivo system, we developed a construct that can be used to measure the amount of transcription, translation, or both! The details of this construct can be found on the design page (link).  

Revision as of 01:13, 29 October 2017



One of these sequences is a toxin.

Do you know which?

ACAGTTACACGGACAACAAGGTGTTCCAGGCTTCTTTCCTCCCTTCGACGATGTATTTCCAATAGGTGTAATCGTCGGCGAAATCGTGTTCGGTTCTCCCGACGACTGCGAAGGAAACGGATTGTTCGGTGTATTCGGCGTGTACAGCAGAATTTCACCCGACAGCGGTCCTTCTTCACCAAATCCCAGCGGCGGCGG

CTGCGCGATGCTCGACGAGTCAATTCCGCTGTAGTACAGGAAGTCGTACGAGTCATTGCTATTGTATCAGCTAGAGATAATCGCGTACGCGCTCGAGCTCGAGCTATTTCGTCCTGAGCTGATGTCTCCGTCGATAATGAAAAATCCTCCGCTGATGTCCAGGTACAGACCCAGTCCGTCGTATCCTCCAATCGCTGA

GGTGCGAAGATTGACGACCCGCTCTATATTCATCATGTGTGGCCGCATGACCCGACAATTACACATTTCATTTTAAAGCTCGCGCATGCGATTGACATTGACATTACACTATATGAAATTAAGCCGTATCCGAAGCTCTGGCGTTATTATATTAAGCCGGTGCATGTGTCTGTGTATCCGCATTATTATCTCGCGGAA

AGGCACTTCCTACTTCTTAAGAAACGGCTAAGCAGCAGAGTTAAGAGCCTTAAGTCACTATCAAGCCCGCTAGTATTCAAACACAGCCACCTACTTCTACTTCTATCATGGCGGATGCTATTCAAGCGGAAGTTCAAAGTTTGCCGGCGGCTATTCAAGAGAAGCAGACCAAGACGGAAGAGCCGGCGGAAACACATG

V

The Next vivo Connection

As an additional tool outside the Next vivo system, we developed a construct that can be used to measure the amount of transcription, translation, or both! The details of this construct can be found on the design page (link). Using a purified T7 polymerase we in vitro transcribed the full validation construct. After adding DHFBI, the fluorophore, we were able to observe green fluorescence (Figure 2).

Will’s spinach figure.

Figure 2 - Characterization of the EYFP-Spinach validation construct.

From these results we are confident that we can produce the Spinach RNA and use it as a measure of transcriptional activity for our Next vivo system or T7 polymerase alone.

tRNA Purification

The biggest issue we initially faced in developing Next vivo was determining how we could purify tRNA quickly and efficiently. The solution we decided upon was an adapted MS2 purification combined with a subsequent incubation with RNase H and a DNA oligo that would selectively cleavage and release a tRNA of the proper size. For more information on the design, see the tRNA purification section here. (link)

Both the tRNAPhe-MS2 construct and MS2BP were expressed individually in E. coli BL21 DE3 cells. Upon which time the cells were lysed, the lysate combined, and applied to a Nickel-sepharose affinity column. The MS2BP is able to bridge the nickel sepharose column and the tRNA-MS2 allowing the tRNA to be isolated from the cell lysate.

Graeme’s illustrious post and pre cigarette images of tRNA purification.

Figure Y - Whatever Graeme has.

Transcription Validation

Future Plans

Work on the Next vivo system will not end with the iGEM competition and will be carried on by several team members going forward.

  • Perform the multi-protein purification with all Next vivo TX-TL components
  • Test purified tRNAPhe for aminoacylation efficiency (how efficient the amino acid can be attached)
  • Design and order the remaining 19 tRNA needed to encode the 20 standard amino acids
  • Insert the MS2 tag into the ribosomal RNA genes to test purification of the ribosome
  • Test Next vivo purified release factors (translation components) in the PUREexpress kits lacking these factors for viability
  • Design a troubleshooting module to determine which components are non-functional