Keithaiken (Talk | contribs) |
Kristiturton (Talk | contribs) |
||
Line 96: | Line 96: | ||
<tr> | <tr> | ||
− | <td><a href="https://static.igem.org/mediawiki/2017/f/fc/Purification_of_Poly-Histidine_Tagged_Proteins.pdf" target="_blank">Purification of | + | <td><a href="https://static.igem.org/mediawiki/2017/f/fc/Purification_of_Poly-Histidine_Tagged_Proteins.pdf" target="_blank">Purification of HexaHistidine Tagged Proteins</a></td> |
<td><a href="https://static.igem.org/mediawiki/2017/1/10/Restriction_Enzyme_Digest_and_Dephosphorylation.pdf" target="_blank">Restriction Enzyme Digest and Dephosphorylation</a></td> | <td><a href="https://static.igem.org/mediawiki/2017/1/10/Restriction_Enzyme_Digest_and_Dephosphorylation.pdf" target="_blank">Restriction Enzyme Digest and Dephosphorylation</a></td> | ||
</tr> | </tr> |
Revision as of 18:18, 29 October 2017
Protocols
Products/Reagents
Enzymes | Buffers/Reagents | Other Products |
---|---|---|
Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
Phusion Polymerase Master Mix | Kanomycin / Chloramphenicol / Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | Dialyzation Membrane |
PURExpressKit (New England Biolabs) | Phenol | |
XbaI (NEB) | Chloroform | |
SpeI (NEB) | 10x PFU Buffer | |
PstI (NEB) | NTP | |
EcoRI (NEB) | GMP | |
Dream Taq DNA Polymerase | 10x Taq Buffer | |
Taq DNA Polymerase | Ligase Buffer | |
RNAse A | SDS-PAGE Reagents | |
TraB | Urea PAGE reagents | |
iPPase | Agarose | |
RNAse Inhibitor | Agar | |
DNAseI | Tryptone | |
Yeast Extract | ||
TAKMz | BioBasic Plasmid DNA miniprep Kit | |
Imidazole |