Difference between revisions of "Team:Lethbridge/Experiments"
Keithaiken (Talk | contribs) |
Keithaiken (Talk | contribs) |
||
| Line 26: | Line 26: | ||
@media only screen and (max-width: 500px) { | @media only screen and (max-width: 500px) { | ||
| + | #allContent {margin-left: 1%; margin-right: 1%;} | ||
#proreaTable td, th {border: 1px solid black; text-align: center; padding: 4px;} | #proreaTable td, th {border: 1px solid black; text-align: center; padding: 4px;} | ||
#proreaTable tr td {font-size: calc(6px + 0.25vw) !important; line-height: calc(1em + 0.5vw) !important; text-align: center !important; vertical-align: top;} | #proreaTable tr td {font-size: calc(6px + 0.25vw) !important; line-height: calc(1em + 0.5vw) !important; text-align: center !important; vertical-align: top;} | ||
Revision as of 20:35, 29 October 2017
Protocols
Products/Reagents
| Enzymes | Buffers/Reagents | Other Products |
|---|---|---|
| Shrimp Alkaline Phosphatase | Affinity Chromatography Buffers | Ni²+ Affinity Resin |
| DNA Blunting Enzyme | IPTG | Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’ |
| Phusion Polymerase Master Mix | Kanomycin / Chloramphenicol / Ampicillin | Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’ |
| PFU Polymerase | Dimethyl Sulfur Dioxide | Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’ |
| T7 RNA Polymerase | Competent Cell Buffers | Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’ |
| T7 DNA Polymerase | T7 RNA Polymerase Purification Buffers | Dialyzation Membrane |
| PURExpressKit (New England Biolabs) | Phenol | |
| XbaI (NEB) | Chloroform | |
| SpeI (NEB) | 10x PFU Buffer | |
| PstI (NEB) | NTP | |
| EcoRI (NEB) | GMP | |
| Dream Taq DNA Polymerase | 10x Taq Buffer | |
| Taq DNA Polymerase | Ligase Buffer | |
| RNAse A | SDS-PAGE Reagents | |
| TraB | Urea PAGE reagents | |
| iPPase | Agarose | |
| RNAse Inhibitor | Agar | |
| DNAseI | Tryptone | |
| Yeast Extract | ||
| TAKMz | ||
| BioBasic Plasmid DNA miniprep Kit | ||
| Imidazole |
