Team:Lethbridge/Experiments

LB Media

Agarose Gel Extraction

PCR Amplification

Colony PCR

DNA PUrification from Enzymatic Reactions

PCR product Purification

In Vitro Transcription

Ligations

Phenol/Chloroform Extraction and Ethanol Precipitation

pJET Cloning

Plasmid Miniprep

Preparation of Chemical Competent Cells

Protein Overexpression

PURExpress NEB Kit

Purification of Poly-Histidine Tagged Proteins

Restriction Enzyme Digest and Dephosphorylation

T7- RNA Polymerase Purification

Transformation

table { font-family: arial, sans-serif; border-collapse: collapse; width: 100%; } td, th { border: 1px solid black; text-align: left; padding: 8px; } tr:nth-child(even) { background-color: white; }
Enzymes Buffers/Reagents Other Products
Shrimp Alkaline Phosphatase Affinity Chromatography Buffers Ni²+ Affinity Resin
DNA Blunting Enzyme IPTG Prefix Forward: 5’GAATTCGCGGCCGCTTCTAG3’
Phusion Polymerase Master Mix Kanomycin/Chloramphenicol/Ampicillin Prefix Reverse: 5’CTGCAGCGGCCGCTACTAGTA3’
PFU Polymerase Dimethyl Sulfur Dioxide Prefix Forward +6:5’GGCTCAGAATTCGCGGCCGCTTCTAGAG3’
T7 RNA Polymerase Competent Cell Buffers Suffix Reverse +6: 5’CTGGACCTGCAGCGGCCGCTACTAGTA3’
T7 DNA Polymerase T7 RNA Polymerase Purification Buffers
PURExpressKit (New England Biolabs) Phenol
XbaI (NEB) Chloroform
SpeI (NEB) 10x PFU Buffer
PstI (NEB) NTP
EcoRI (NEB) GMP
Dream Taq DNA Polymerase 10x Taq Buffer
Taq DNA Polymerase Ligase Buffer
RNAse A SDS-PAGE Reagents
TraB Urea PAGE reagents
iPPase Agarose
RNAse Inhibitor Agar
Tryptone
Yeast Extract
BioBasic Plasmid DNA miniprep Kit