One of these sequences is a toxin.

Do you know which?

ACAGTTACACGGACAACAAGGTGTTCCAGGCTTCTTTCCTCCCTTCGACGATGTATTTCCAATAGGTGTAATCGTCGGCGAAATCGTGTTCGGTTCTCCCGACGACTGCGAAGGAAACGGATTGTTCGGTGTATTCGGCGTGTACAGCAGAATTTCACCCGACAGCGGTCCTTCTTCACCAAATCCCAGCGGCGGCGG

CTGCGCGATGCTCGACGAGTCAATTCCGCTGTAGTACAGGAAGTCGTACGAGTCATTGCTATTGTATCAGCTAGAGATAATCGCGTACGCGCTCGAGCTCGAGCTATTTCGTCCTGAGCTGATGTCTCCGTCGATAATGAAAAATCCTCCGCTGATGTCCAGGTACAGACCCAGTCCGTCGTATCCTCCAATCGCTGA

GGTGCGAAGATTGACGACCCGCTCTATATTCATCATGTGTGGCCGCATGACCCGACAATTACACATTTCATTTTAAAGCTCGCGCATGCGATTGACATTGACATTACACTATATGAAATTAAGCCGTATCCGAAGCTCTGGCGTTATTATATTAAGCCGGTGCATGTGTCTGTGTATCCGCATTATTATCTCGCGGAA

AGGCACTTCCTACTTCTTAAGAAACGGCTAAGCAGCAGAGTTAAGAGCCTTAAGTCACTATCAAGCCCGCTAGTATTCAAACACAGCCACCTACTTCTACTTCTATCATGGCGGATGCTATTCAAGCGGAAGTTCAAAGTTTGCCGGCGGCTATTCAAGAGAAGCAGACCAAGACGGAAGAGCCGGCGGAAACACATG

V

The Next vivo Connection

As an additional tool outside the Next vivo system, we developed a construct that can be used to measure the amount of transcription, translation, or both! The details of this construct can be found on the design page (link). Using a purified T7 polymerase we in vitro transcribed the full validation construct. After adding DHFBI, the fluorophore, we were able to observe green fluorescence (Figure 2).

Will’s spinach figure.

Figure 2 - Characterization of the EYFP-Spinach validation construct.

From these results we are confident that we can produce the Spinach RNA and use it as a measure of transcriptional activity for our Next vivo system or T7 polymerase alone.

tRNA Purification

The biggest issue we initially faced in developing Next vivo was determining how we could purify tRNA quickly and efficiently. The solution we decided upon was an adapted MS2 purification combined with a subsequent incubation with RNase H and a DNA oligo that would selectively cleavage and release a tRNA of the proper size. For more information on the design, see the tRNA purification section here. (link)

Both the tRNAPhe-MS2 construct and MS2BP were expressed individually in E. coli BL21 DE3 cells. Upon which time the cells were lysed, the lysate combined, and applied to a Nickel-sepharose affinity column. The MS2BP is able to bridge the nickel sepharose column and the tRNA-MS2 allowing the tRNA to be isolated from the cell lysate.

Graeme’s illustrious post and pre cigarette images of tRNA purification.

Figure Y - Whatever Graeme has.

Transcription Validation

Future Plans

Work on the Next vivo system will not end with the iGEM competition and will be carried on by several team members going forward.

Perform the multi-protein purification with all Next vivo TX-TL components
Test purified tRNAPhe for aminoacylation efficiency (how efficient the amino acid can be attached)
Design and order the remaining 19 tRNA needed to encode the 20 standard amino acids
Insert the MS2 tag into the ribosomal RNA genes to test purification of the ribosome
Test Next vivo purified release factors (translation components) in the PUREexpress kits lacking these factors for viability
Design a troubleshooting module to determine which components are non-functional