Page title matches
Page text matches
- {{Team:BostonU_Hardware/CSS}} <h2><a href="https://2017.igem.org/Team:Harvard"><img src="https://static.igem.org/mediawiki/2017/1/19/MARS_Harvard22 KB (3,115 words) - 23:26, 1 November 2017
- ...\//g) || []).length ) == 0 ) { // if it is the home page , just print the team's name // this adds the team's name as an h1234 KB (33,316 words) - 03:33, 2 October 2017
- <p>Below nomenclature at the example of <b><u>y</u>our <u>f</u>avorite <u>g</u>ene 1, <i>YFG1</i></b> is explain ...educated guesses which is first verified by <a href="https://2017.igem.org/Team:Cologne-Duesseldorf/Model#h2-1">molecular dynamics</a> and later experiment199 KB (29,417 words) - 03:20, 2 November 2017
- /* EXAMPLE 2 (larger logo) - simply adjust top bottom padding to make logo larger */ /* EXAMPLE 311 KB (1,383 words) - 14:11, 1 November 2017
- ...ipate in iGEM competition, all of the teams above helped us setting up our team. We also conducted a survey and asked iGEM teams above the questions about ...e, and how to collect sponsors and patrons. For the website, iGEM nagahama team actually used the website ‘campfire’, which we also used in advance and20 KB (3,201 words) - 03:51, 2 November 2017
- .example {width:96%; margin-left:0px;} .example {width:96%; margin-left:0px;}36 KB (4,715 words) - 20:28, 1 November 2017
- ...; color: #888888; background-color: #eee;"> <a href="https://2017.igem.org/Team:TUDelft/mail/june" style="color:#888; text-decoration:underline; font-weigh ...; color: #888888; background-color: #eee;"> <a href="https://2017.igem.org/Team:TUDelft/mail/july" style="color:#888; text-decoration:underline; font-weigh101 KB (13,206 words) - 01:58, 1 November 2017
- <a href="https://2017.igem.org/Team:Kyoto/Collaborations#Kansai">Team Kyoto</a>, <a href="https://2017.igem.org/Team:Nagahama/Collaborations">Team Nagahama</a>,8 KB (1,165 words) - 17:29, 1 November 2017
- <a href="https://2017.igem.org/Team:Aalto-Helsinki/Community">Overview</a><br> <a href="https://2017.igem.org/Team:Aalto-Helsinki/Parts">Parts</a><br>12 KB (1,935 words) - 09:42, 31 October 2017
- <link href="https://2017.igem.org/Team:Utrecht/Template:OpenSans/CSS?action=raw&ctype=text/css" rel="stylesheet"> <link href="https://2017.igem.org/Team:Utrecht/Template:NunitoSans/CSS?action=raw&ctype=text/css" rel="stylesheet"125 KB (17,334 words) - 16:58, 27 October 2017
- ...edit and build your team wiki based on the default template given to your team. You will find code examples that you can simply copy and paste on your wik <a href="https://2017.igem.org/Template:Example2"> Template: Example 2 </a></p>18 KB (2,774 words) - 19:19, 16 October 2017
- <div id="team-members" class="section"> ...to practice. Particularly exciting, is the interdisciplinary aspect of the team, which allows you to create very inventive and innovative ideas and to real33 KB (4,234 words) - 00:56, 16 December 2017
- ...th rate, like in classical Lotka-Volterra predator-prey models. But a good example in the paratransgenesis problem, where your objective is stop the pathogen ...ation in every single variation, as small as you want, of the unit, in our example, time.</p>20 KB (3,218 words) - 03:55, 2 November 2017
- ...Being the first UK state school to go to the Giant Jamboree in Boston, our team felt our work was noteworthy enough to have an involvement on IRIS. When we ...ds to be promoted within society and politics. This march caused the whole team, not only those who attended, to reflect on the importance of the march and15 KB (2,561 words) - 22:04, 1 November 2017
- ...emented in the future. Please check out our <a href="https://2017.igem.org/Team:UNebraska-Lincoln/HP/Gold_Integrated">Integrated Human Practices</a> page t ...can develop your own Safety Case, visit our <a href="https://2017.igem.org/Team:UNebraska-Lincoln/Safety">Safety</a> page.</p>27 KB (4,254 words) - 03:54, 2 November 2017
- {{:Team:NTHU_Taiwan/MenuBar}} ...out what the world lacks and to dedicate our ability to the needs. In our team, the concern of environment and health are the ultimate targets. The crisis37 KB (5,801 words) - 16:33, 1 November 2017
- ...0px 10px; font-size:15px;">I know what you did last summer! KU Leuven iGEM Team 2017 has gone through some ups and downs, but that didn't stop them from be ...ur leader to guide us all the way through to the end of the project? Every team member was assigned a subcategory, which they will complete with passion an28 KB (4,112 words) - 00:14, 2 November 2017
- <p> Create a page on your team wiki with clear attribution of each aspect of your project. This page must Judges often wonder what a team has accomplished themselves. This page is your opportunity to explain what16 KB (2,481 words) - 16:20, 10 February 2017
- ...Being the first UK state school to go to the Giant Jamboree in Boston, our team felt our work was noteworthy enough to have an involvement on IRIS. When we ...ds to be promoted within society and politics. This march caused the whole team, not only those who attended, to reflect on the importance of the march and15 KB (2,539 words) - 21:33, 1 November 2017
- ...xamples .example .icon{font-size:20px;float:left;width:35px}.iconExamples .example .class{text-align:center;float:left;margin-top:0;font-weight:400;margin-lef151 KB (17,441 words) - 16:21, 19 July 2017
- ...s. However, these parts rarely get reused. For example, the Cambridge iGEM team (2009) developed a library of sensitivity tuners which were able to convert ...hange lengths. AHL receptors are sensitive to AHLs of specific length. For example, it has been found that the Rhl system, producing and detecting AHL of acyl31 KB (4,558 words) - 19:01, 1 November 2017
- <img alt="Prof. Rudin, Dr. Schröter and the team" <p class="interviewee">Yes. There’s for example BCG, Bacillus Calmette-Guérin, which is approved to treat bladder cancer a54 KB (8,647 words) - 00:39, 2 November 2017
- ...ients who have a moderate or severe acute exacerbation. Short courses (for example, five days) of oral corticosteroids can prevent further worsening of COPD, ...oved for patients with severe COPD and symptoms of chronic bronchitis. One example is roflumilast (Daliresp), a phosphodiesterase-4 inhibitor. This drug decre101 KB (15,605 words) - 19:14, 15 December 2017
- <li><a href="https://2017.igem.org/Team:Wageningen_UR">Home</a></li> <li><a href="https://2017.igem.org/Team:Wageningen_UR/Applied_Design">Application</a></li>539 KB (47,132 words) - 22:34, 1 November 2017
- <a class="navbar-brand" href="https://2017.igem.org/Team:SJTU-BioX-Shanghai"><img src="https://static.igem.org/mediawiki/2017/b/be/T ...<li class="nav-item"><a href="https://2017.igem.org/Team:SJTU-BioX-Shanghai/Description" class="nav-link">Project</a></li>31 KB (3,690 words) - 03:43, 2 November 2017
- {{Team:TUST_China/TUST_meau}} {{Team:TUST_China/CSS/HP}}16 KB (2,135 words) - 00:23, 2 November 2017
- document.getElementById("Team").style.display = "block"; document.getElementById("Team").style.display = "none";70 KB (8,831 words) - 21:27, 15 December 2017
- {{:Team:Edinburgh_UG/Templates/NavigationBar}} ...to facilitate creative breakthroughs and provide new perspectives [1]. For example,19 KB (2,377 words) - 21:18, 1 November 2017
- <h1>Example Form</h1> <p>This is the example form you can use to create new ones! </p>11 KB (1,188 words) - 21:18, 20 March 2018
- ...to answer is: How quickly will the device be able to produce a result? For example, if the bacteria take a long time to grow, they will have to be left in the ...mmer, we were only able to do experiments on <i>E. coli</i>. Therefore, an example model was developed for demonstrating how we could estimate the amount of t17 KB (2,446 words) - 01:42, 2 November 2017
- <p>The history of our team is quite interesting. We didn't start with iGEM, but at the United Nations ...o got the chance to share our thoughts in an article written by one of the team members. It was reviewed by Dr Mahaletchumy Arujanan, major science communi43 KB (5,314 words) - 03:51, 2 November 2017
- document.getElementById("Team").style.display = "block"; document.getElementById("Team").style.display = "none";82 KB (10,755 words) - 21:40, 15 December 2017
- document.getElementById("Team").style.display = "block"; document.getElementById("Team").style.display = "none";79 KB (10,460 words) - 21:40, 15 December 2017
- <h1>1. Team Wiki </h1> <div class="title_extra" > Team Wiki </div>10 KB (1,558 words) - 17:28, 1 August 2017
- ...<br>also known as the aluminum BioBrick Trophy; best overall undergraduate team project</p> ...rst Runner-Up Undergraduate</b> <br>the next highest ranking undergraduate team project</p>18 KB (2,990 words) - 17:56, 15 September 2017
- ...team should take pride in the wiki and we recommend that everyone on your team help contribute some material for it. <p>This is also how the team's <b><i>judges</b></i> will first learn about your project, so you should m18 KB (3,140 words) - 15:20, 27 January 2017
- {{Team:Lethbridge_HS/normalizecss}} {{Team:Lethbridge_HS/reset}}11 KB (1,751 words) - 18:13, 31 October 2017
- <li><a href="https://2017.igem.org/Team:Wageningen_UR">Home</a></li> <li><a href="https://2017.igem.org/Team:Wageningen_UR/Human_Practices">Human Practices</a></li>92 KB (8,708 words) - 16:44, 1 November 2017
- .team-member-img { <h1 class="teampageheadline">MEET THE TEAM</h1>40 KB (5,182 words) - 01:42, 16 December 2017
- <meta name="Team" content="BNU-China" > ...<li id="w_Project"><a class="w_a" href="https://2017.igem.org/Team:BNU-China/Description">Project</a></li>25 KB (3,375 words) - 01:58, 2 November 2017
- <div class="title_extra" > Previous: Team Wiki</div> <div class="title_extra" > Team Wiki </div>6 KB (866 words) - 23:38, 9 February 2017
- ...w) will generate a table with all of the parts that your team adds to your team sandbox.</p> ...re likely to find parts by looking in the Registry than by looking at your team wiki.</p>12 KB (1,963 words) - 17:15, 22 July 2017
- {{Team:Lethbridge_HS/normalizecss}} {{Team:Lethbridge_HS/reset}}4 KB (523 words) - 19:52, 29 October 2017
- ...nto very different parts of the project. Of course, the larger part of the team is involved into the lab work at some point, but other tasks have to be cov ...agnostX--Pfeile.png"> <h5 class="d-inline pl-3 my-3"> How can such a large team work?</h5>33 KB (4,804 words) - 01:17, 16 December 2017
- ...tude of a bacterial population that can reach billions of individuals. For example, in the large intestine, home to many bacteria, there are approximately 14 ...example by trapping for some resources like iron) or to destroy them! (for example by producing toxins) However, although in the game all bacteria are able to108 KB (14,779 words) - 22:53, 1 November 2017
- {{:Team:UNOTT/Template/NavBarTest}} <h1 style="text-align: center; color: #ffffff;">OUR TEAM</h1>25 KB (3,836 words) - 00:20, 2 November 2017
- {{Team:Calgary/BasicPage <p>Our team decided to educate future scientists in our community by developing educati22 KB (3,356 words) - 03:26, 13 December 2017
- ...a> and <a href="https://2017.igem.org/Team:Example2/Model">Model</a>. Your team can complete the Gold Integrated page to compete for the HP gold medal crit ...ecific awards and medal criteria with static (unchangeable) links. If your team wants to be evaluated for an award/medal, you will need to document your ac12 KB (1,952 words) - 17:01, 27 October 2017
- <link rel="stylesheet" href="https://2017.igem.org/Team:Cornell/bootstrapCSS?action=raw&ctype=text/css"> <link rel="stylesheet" href="https://2017.igem.org/Team:Cornell/styles?action=raw&ctype=text/css"> <!--For nav bar text-->42 KB (5,720 words) - 00:38, 31 October 2017
- Judd-UK is the only other UK high school team. Luckily, they’re only a short train journey away. Their [[Team:Judd_UK/Collaborations|collaborations page]] mentions us too!13 KB (1,886 words) - 17:26, 1 November 2017
- ...EM Conference in Copenhagen and Global Community Bio Summit in Boston. Our team also had the chance to engage with exchange students from universities in C ...be confronted with, and summarizes it with a few questions that every iGEM team, in our opinion, should be able to answer. By this we want to contribute to26 KB (3,615 words) - 23:55, 1 November 2017
- {{:Team:CSMU_NCHU_Taiwan/Templates/Header}} looking for using this website.<br><br>For example: Thioredoxin<br>We understood through this website that the protein’s ami13 KB (1,558 words) - 17:44, 1 November 2017
- <h3> Example 1 </h3> ...team) tries to use their position as judge to convince other judges their team deserves an award. (iGEM judging policy clearly forbids this.) If this happ5 KB (809 words) - 17:58, 11 November 2017
- See our [[Team:CLSB-UK/Engagement|engagement]] and [[Team:CLSB-UK/HP/HS_Guide|high schools guide]] for more details. ...tory consultants. You can view a more precise breakdown of the responses [[Team:CLSB-UK/HP/Silver/Survey_Responses|here]].79 KB (11,332 words) - 02:06, 2 November 2017
- ...stakeholders participated in our project <i><a href="https://2017.igem.org/Team:TUDelft/Engagement#videos" target="_blank" >How can iGEM teams best include ...height: 3%; width: 40%;" class="modal-trigger" href="https://2017.igem.org/Team:TUDelft/Design#vesicles"></a>133 KB (11,560 words) - 16:51, 14 December 2017
- {{:Team:Manchester/Templates/NavBar}} ...ch directly impacted the development of our <a href="https://2017.igem.org/Team:Manchester/Entrepreneurship">business plan</a> and consequently shaped our38 KB (6,017 words) - 22:50, 30 October 2017
- ...rise to the top. However, after collaborating with the IISc Bangalore 2017 team, who is also working with gas vesicles, they informed us that diffusion pla ...s that could help the both teams succeed. In the future, Team UAlberta and Team IISc will continue to benefit heavily by combining their manpower and resou15 KB (2,280 words) - 03:41, 2 November 2017
- {{Team:Bielefeld-CeBiTec/Head}} {{Team:Bielefeld-CeBiTec/Header}}39 KB (5,875 words) - 03:34, 2 November 2017
- ...bg-primary fixed-top"><a class="navbar-brand" href="https://2017.igem.org/Team:Waterloo">Waterloo</a><button class="navbar-toggler navbar-toggler-right" t <li class="nav-item"><a class="nav-link" href="https://2017.igem.org/Team:Waterloo"><span>Home</span></a></li>33 KB (5,128 words) - 02:02, 2 November 2017
- document.getElementById("Team").style.display = "block"; document.getElementById("Team").style.display = "none";81 KB (10,272 words) - 21:27, 15 December 2017
- <li class="pure-menu-item"><a href="https://2017.igem.org/Team:NUDT_CHINA" class="pure-menu-link">HOME</a></li> <a class="pure-menu-link"onclick="Show('team_show')">TEAM</a>18 KB (2,264 words) - 03:51, 2 November 2017
- ...criteria are simpler in 2017 as there are only two sets depending on your team's track. Teams need to meet all the deliverables in section 4 of the 2017 c <p> Create a page on your team wiki with clear attribution of each aspect of your project. This page must13 KB (1,989 words) - 15:17, 16 October 2017
- {{Example}} <p>This page is used by the judges to evaluate your team for the <a href="https://2017.igem.org/Judging/Medals">medal criterion</a>2 KB (329 words) - 18:59, 26 March 2018
- As such, we are partnering with iGEM in order to better understand team work and collaborative behavior in the context of an open scientific challe ...set in its team members. In such a case, it is of immense advantage for a team to ask for help from other teams. Cases like these make iGEM teams reach ou11 KB (1,615 words) - 19:17, 16 October 2017
- {{:Team:UNOTT/Template/NavBarTest}} <p>Along with modeling all the possible combinations, another issue the team faced was they wouldn't be able to compare the read fluorescence spectra a24 KB (3,589 words) - 03:58, 2 November 2017
- <a class="navbar-brand" href="https://2017.igem.org/Team:NYU_Abu_Dhabi"> <a class="nav-link" href="https://2017.igem.org/Team:NYU_Abu_Dhabi">Home <span class="sr-only">(current)</span></a>19 KB (2,607 words) - 19:55, 1 November 2017
- ...teams, hosted seminars at home for team communication in corporation with Team Tsinghua and reached mutual technical collaboration with several others. <b <div class="myTitle2" >I <a href="https://2017.igem.org/Team:Fudan/Collaborations">Fudan</a> </div>13 KB (1,828 words) - 03:34, 2 November 2017
- <p>Our HP projects this year were diverse and palpably profound. All team members engaged in those Team Franconia, live in Bavaria, a federal state who executed this reform as one33 KB (4,771 words) - 16:22, 11 December 2017
- ...cover.jpg|Integrated Human Practices|To the disappointment of our modeling team, this page does not involve any calculus}} See the [[Team:CLSB-UK/Results|results page]] for more details.36 KB (5,492 words) - 03:10, 2 November 2017
- <a href="https://2017.igem.org/Team:SYSU-Software/Project" class="page-link">Project</a> <a href="https://2017.igem.org/Team:SYSU-Software/Project#description" class="item">Description</a>22 KB (2,794 words) - 17:01, 20 November 2017
- <div class="box2 right project" href="https://2017.igem.org/Team:TAS_Taipei/Background"> <div class="box2 right experiment" href="https://2017.igem.org/Team:TAS_Taipei/Experimental_Summary">65 KB (7,138 words) - 15:14, 14 December 2017
- ...ave low amounts of interference and form a functional genetic circuit. Our team has built 3 new receivers. </p> <p> Our iGEM team is investigating the diverse applications that fit with our quorum sensing27 KB (4,160 words) - 03:59, 2 November 2017
- <a href="https://2017.igem.org/Team:Mingdao" class="w3-bar-item w3-button w3-padding-large w3-white">Home</a> <a href="https://2017.igem.org/Team:Mingdao/Achievements" class="w3-bar-item w3-button w3-hide-small w3-padding173 KB (19,889 words) - 16:09, 1 November 2017
- ...m:INSA-UPS_France/HP/Silver">Silver</a> and <a href="https://2017.igem.org/Team:INSA-UPS_France/Entrepreneurship/Testimonies">Testimonies</a> by building a ...hical matrix, its purpose is to highlight the decision process done by the team at every step of the project in the respect and integrity of stakeholders.59 KB (7,835 words) - 00:06, 2 November 2017
- <a href="https://2017.igem.org/Team:Mingdao" class="w3-bar-item w3-button w3-padding-large w3-white">Home</a> <a href="https://2017.igem.org/Team:Mingdao/Demonstrate" class="w3-bar-item w3-button w3-hide-small w3-padding-173 KB (19,872 words) - 07:26, 30 October 2017
- <li><a href="https://2017.igem.org/Team:Wageningen_UR">Home</a></li> <li><a href="https://2017.igem.org/Team:Wageningen_UR/Human_Practices">Human Practices</a></li>44 KB (4,933 words) - 17:07, 1 November 2017
- ...ject, describe what moves you and why this is something important for your team.</p> <li align="left">A detailed explanation of why your team chose to work on this particular project.</li>26 KB (3,857 words) - 00:57, 30 May 2017
- ...ject, describe what moves you and why this is something important for your team.</p> <li align="left">A detailed explanation of why your team chose to work on this particular project.</li>26 KB (3,857 words) - 17:15, 22 July 2017
- {{:Team:UNOTT/Template/NavBarTest}} <p> The team applied Law of Mass Action, combining both equations for the concentration27 KB (3,901 words) - 03:53, 2 November 2017
- <a href="https://2017.igem.org/Team:SCU_China">Home</a> <li><a href="https://2017.igem.org/Team:SCU_China/Repressilator">Repressilator</a>36 KB (3,424 words) - 00:25, 31 October 2017
- <div class="title_extra" > Team Wiki </div> <p>Each team is given one poster slot, students must present the poster during the sched7 KB (1,018 words) - 23:42, 9 February 2017
- ...ogo-vigne" src="https://static.igem.org/mediawiki/2017/f/fb/Ionis-paris-hp-team.jpg"></img> ...ogo-vigne" src="https://static.igem.org/mediawiki/2017/f/fb/Ionis-paris-hp-team.jpg"></img>19 KB (2,560 words) - 03:39, 2 November 2017
- {{Template:Team:Tec-Chihuahua/header}} ...cutting-edge that can bring great success, as it can ease the plague. Our team is composed of Biotechnology undergraduates, and our product consists of a50 KB (7,497 words) - 02:31, 16 December 2017
- ...ogo-vigne" src="https://static.igem.org/mediawiki/2017/f/fb/Ionis-paris-hp-team.jpg"></img> ...ogo-vigne" src="https://static.igem.org/mediawiki/2017/f/fb/Ionis-paris-hp-team.jpg"></img>19 KB (2,560 words) - 00:18, 2 November 2017
- <li class="pure-menu-item"><a href="https://2017.igem.org/Team:NUDT_CHINA" class="pure-menu-link">HOME</a></li> <a class="pure-menu-link"onclick="Show('team_show')">TEAM</a>32 KB (4,019 words) - 03:44, 2 November 2017
- <p>Before we started with this work in the lab, all team members had to pass different safety tests and receive training during an i ...for by thinking the experiments through beforehand. For this purpose, our team Safety Manager, Isabell Trinh, wrote safety proposals for our experiments.9 KB (1,440 words) - 10:45, 14 December 2017
- {{Team:Bielefeld-CeBiTec/Head}} {{Team:Bielefeld-CeBiTec/Header}}41 KB (5,805 words) - 03:54, 2 November 2017
- ...nces we found, to design the crRNAs for the <a href="https://2017.igem.org/Team:TUDelft/Design#cas13a" target="_blank">lab</a>. Furthermore, we checked the ...the dynamics of the transport of proteins (<a href="https://2017.igem.org/Team:TUDelft/Design#vesicles" target="_blank">TorA-GFP</a>) from the cytoplasm i69 KB (9,779 words) - 03:15, 2 November 2017
- {{:Team:Edinburgh_UG/Templates/NavigationBar}} ...extensively explain how SSR occurs, using the popular Cre/Lox system as an example. </p>43 KB (4,680 words) - 23:05, 1 November 2017
- <p>Below nomenclature at the example of <b><u>y</u>our <u>f</u>avorite <u>g</u>ene 1, <i>YFG1</i></b> is explain ...educated guesses which is first verified by <a href="https://2017.igem.org/Team:Cologne-Duesseldorf/Model#h2-1">molecular dynamics</a> and later experiment105 KB (15,409 words) - 02:56, 2 November 2017
- PEX5 variant R3 with the PTS1 variant -YDSYD. This shows an example for a unfavorable result − the receptor prefers the PTS1 above the PT ...variant with the PTS1 and the blue with the PTS1*. The figure above is an example for an unfavorable result − one sees that wild type signal is prefere47 KB (6,978 words) - 15:22, 1 November 2017
- {{:Team:Edinburgh_UG/Templates/NavigationBar}} ...rms with a high syllable count have no short and accurate substitutes. For example, “significance” has many24 KB (2,996 words) - 23:29, 1 November 2017
- <p>Below nomenclature at the example of <b><u>y</u>our <u>f</u>avorite <u>g</u>ene 1, <i>YFG1</i></b> is explain ...educated guesses which is first verified by <a href="https://2017.igem.org/Team:Cologne-Duesseldorf/Model#h2-1">molecular dynamics</a> and later experiment98 KB (14,470 words) - 00:02, 2 November 2017
- ...s page is focused on helping teams navigate through iGEM. Starting an iGEM team and getting a project started can be a challenge even for returning teams. <p>Students and instructors who are interesting in having an iGEM team for the upcoming season often begin preparing during November through Febru8 KB (1,380 words) - 19:41, 7 February 2017
- ...but also consider creating a brochure in which you state the goals of your team. </p> ...doing and be careful to not overwhelm them. Having a team identity (logo, team color, presentation layout, etc.) will help you look professional and serio9 KB (1,470 words) - 04:10, 28 September 2017
- .example {width:96%; margin-left:0px;} <h1><a name="jump_top">Team Members</a></h1>24 KB (2,992 words) - 03:25, 17 November 2017
- {{Team:Hamburg/CSS}} <!--- {{Team:Hamburg/javascript/main}} --->12 KB (1,856 words) - 09:58, 1 November 2017
- {{Team:Lethbridge_HS/normalizecss}} {{Team:Lethbridge_HS/reset}}9 KB (1,340 words) - 00:50, 2 November 2017
- <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:DTU-Denmark/stylesheetsub?action=raw&ctype=text/css&?ver=6"> ...gh a documentary. A journalist is filming a documentary about our project, team, and the opportunities of synthetic biology.18 KB (2,533 words) - 23:27, 1 November 2017
- <li><a href="https://2017.igem.org/Team:East_Chapel_Hill">Home</a></li> ...-toggle="dropdown" href="https://2017.igem.org/Team:East_Chapel_Hill/Team">Team12 KB (1,773 words) - 03:02, 2 November 2017
- {{:Team:AHUT_China/Template/CSS_RESET}} ...n" class="navbar-toggle collapsed" data-toggle="collapse" data-target="#bs-example-navbar-collapse-1" aria-expanded="false">33 KB (4,524 words) - 03:37, 2 November 2017
- nav.Unternavigation-Team{ <a href="https://2017.igem.org/Team:Tuebingen">20 KB (2,705 words) - 12:41, 12 December 2017
- {{Team:Hamburg/CSS}} <!--- {{Team:Hamburg/javascript/main}} --->13 KB (1,925 words) - 15:23, 14 December 2017
- <a href="https://2017.igem.org/Team:SCU_China">Home</a> <li><a href="https://2017.igem.org/Team:SCU_China/Repressilator">Repressilator</a>26 KB (2,514 words) - 00:25, 31 October 2017
- <title>Team Michigan: Attributions</title> <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:Michigan/CSS?action=raw&ctype=text/css" />22 KB (3,410 words) - 01:21, 2 November 2017
- ...we were able to attend the symposium for one day with three people of our team. It gave us the opportunity to present our poster during the poster session ...the lecture, we had a discussion where everyone shared their opinions. For example, what changes would you make to our product design, would it be a problem f28 KB (4,313 words) - 03:16, 2 November 2017
- <a href="https://2017.igem.org/Team:Mingdao" class="w3-bar-item w3-button w3-padding-large w3-white">Home</a> <a href="https://2017.igem.org/Team:Mingdao/Achievements" class="w3-bar-item w3-button w3-hide-small w3-padding173 KB (19,889 words) - 05:59, 15 December 2017
- <a href="https://2017.igem.org/Team:Exeter"><img id="logo-top-left" width="100%;" src="https://static.igem.org/ <td><a href="https://2017.igem.org/Team:Exeter/HP/Silver">Human Practices</a></td>47 KB (7,519 words) - 03:19, 2 November 2017
- ...erty</b>: an investor will want the system to be protected by a patent for example; and last but not least, to build a <b>complementary team</b> and <b>keep in mind that one day, the product will arrive in the custom39 KB (4,806 words) - 18:13, 1 November 2017
- <script type="text/javascript" src="https://2017.igem.org/Team:CCU_Taiwan/assets/js/js_anchor? <script type="text/javascript" src="https://2017.igem.org/Team:CCU_Taiwan/assets/js/js_anchor_show?66 KB (10,210 words) - 03:40, 2 November 2017
- <td><ul><li>Risk Group 1 microorganisms <br /> (For example: <i>E. coli</i> K-12, <i>S. cerevisiae</i>, <i>B. subtilis</i>, <i>Lactobac <td><ul><li>Risk Group 2 microorganisms <br /> (For example: <i>Pseudomonas</i> spp.)</li></ul></td>12 KB (2,053 words) - 16:06, 28 June 2017
- {{Team:BostonU_Hardware/CSS}} ...e PDMS layer in order to manipulate fluid flow through the flow layer. For example, by actuating a syringe attached to the control layer, a valve can be opene23 KB (2,954 words) - 02:10, 1 November 2017
- <a href="https://2017.igem.org/Team:Peking"><img <a class="mdl-navigation__link" href="https://2017.igem.org/Team:Peking"170 KB (16,709 words) - 06:32, 15 December 2017
- <a href="https://2017.igem.org/Team:Aalto-Helsinki/Story">Story</a><br> <a style="text-decoration: underline" href="https://2017.igem.org/Team:Aalto-Helsinki/Dialog">Dialog</a><br>22 KB (3,543 words) - 20:36, 11 December 2017
- <p style="font-size: 18px;">Fig2 The team member is introducing the three elements in Synthetic Biology.</p> ...">To demonstrate the concept of logic gate, we made some extension to this example. Logical processing, the application of logic gates, might increase the acc13 KB (1,852 words) - 01:52, 20 November 2017
- <!-- Remember the (Alamo) Template:Team:Dartmouth/etc --> {{Team:Dartmouth/DiGEM17_Style}}6 KB (811 words) - 02:52, 2 November 2017
- ...ls.io/ protocols.io’s API], another protocol database, and contacted the team there to try and get access to the public protocols without the user’s lo ...ry difficult to parse automatically. We talked with [https://2017.igem.org/Team:Michigan_Software/HP Michigan Software], who are looking into standardising9 KB (1,394 words) - 21:59, 27 October 2017
- <link rel="stylesheet" href="https://2014.igem.org/Team:Aalto-Helsinki/bootstrap.min.css?action=raw&ctype=text/css" type="text/ <link rel="stylesheet" href="https://2014.igem.org/Team:Aalto-Helsinki/stylesheet.css?action=raw&ctype=text/css" type="text/css11 KB (1,332 words) - 14:15, 31 October 2017
- ...team SDU_CHINA. We’d like to appreciate professor Yuan and her research team members here! </p> ...is responsible for organizing some activities, such as meet-up activity of team members, propagation iGEM at school campus.</p>6 KB (1,040 words) - 04:37, 22 October 2017
- <p>Biocon's R&D park, located in Bangalore, hosted four members of our team who toured the facility and spoke to the Manager of the R&D division to und ...erest in industrial processes, leading to a <a href="https://2017.igem.org/Team:IISc-Bangalore/HP/Gold_Integrated">more fruitful collaboration</a> with ind9 KB (1,394 words) - 02:38, 2 November 2017
- ...team SDU_CHINA. We’d like to appreciate professor Yuan and her research team members here! </p> ...is responsible for organizing some activities, such as meet-up activity of team members, propagation iGEM at school campus.</p>7 KB (1,072 words) - 00:43, 2 November 2017
- ...team SDU_CHINA. We’d like to appreciate professor Yuan and her research team members here! </p> ...is responsible for organizing some activities, such as meet-up activity of team members, propagation iGEM at school campus.</p>6 KB (1,040 words) - 02:11, 8 October 2017
- {{Team:Macquarie_Australia/Templates/Menu}} <center>{{Team:Macquarie_Australia/Templates/NavBar}}</center>16 KB (2,426 words) - 04:03, 1 November 2017
- xlink:href="https://2017.igem.org/Team:Lund/GoGreen" xlink:href="https://2017.igem.org/Team:TU_Dresden/HP/Gold_Integrated"80 KB (7,755 words) - 01:27, 2 November 2017
- ...g camps to children of all age throughout the elementary summer break. Our team constructed a syllabus, filled with hands-on STEM related activities, as we actively involved and receptive to more and more advanced activities. An example of some activities is provided below.</p>17 KB (2,652 words) - 02:49, 2 November 2017
- <a href='https://2017.igem.org/Team:NTNU_Trondheim'> <a href='https://2017.igem.org/Team:NTNU_Trondheim/Safety'>18 KB (1,780 words) - 03:14, 2 November 2017
- ...ion is to build a strong and long-lasting community to support the current team, and to ensure the future participation of Stockholm in iGEM. </p> ...account which is inherited by every new team, making it easier for the new team to start raising its first - and very necessary - money. </p>2 KB (366 words) - 21:36, 5 December 2017
- <title>Team:BGIC-Union</title> <link href="https://2017.igem.org/Team:BGIC-Union/finalcss/main-css?action=raw&ctype=text/css" rel="stylesheet35 KB (4,728 words) - 02:43, 1 November 2017
- {{:Team:SUSTech_Shenzhen/removeStyles}} {{:Team:SUSTech_Shenzhen/nav}}<!--------子页面导航栏-------------------------6 KB (806 words) - 16:46, 14 December 2017
- {{:Team:Manchester/Templates/NavBar}} ...research made by Martin Warren et al. as documented in the 2017 paper. Our team are planning to target WWTPs in Canada specifically, as we believe it is th30 KB (4,429 words) - 23:38, 1 November 2017
- <a href="#">TEAM</a> <li><a href="https://2017.igem.org/Team:SZU-China/Team">MEMBERS</a></li>38 KB (4,604 words) - 02:39, 2 November 2017
- {{Team:William_and_Mary/CSS_RESET}} {{Team:William_and_Mary/CSS_FIX}}19 KB (2,797 words) - 03:07, 15 December 2017
- {{Template:Team:Tec-Chihuahua/header}} ...biofilm and encouraging the motility. For this last virulence factor, the team proposes to arrest flagellar rotation with a Putative Glycosyltransferase e14 KB (2,115 words) - 01:08, 2 November 2017
- ...ic biology and our project. We explained it as simply as possible using an example of a light switch to explain toehold switches to younger students. For olde ...his by having several different colour fluorescent (glowing) proteins. For example, not just a green one but also red, orange, blue and purple ones. We could11 KB (1,720 words) - 23:15, 31 October 2017
- {{Team:Hamburg/CSS}} <!--- {{Team:Hamburg/javascript/main}} --->32 KB (4,998 words) - 06:18, 24 November 2017
- <li>Collaborated with the University of Toronto iGEM team to design the sgRNA for their project.</li> ...genes</i> CRISPR/Cas9 can only bind and cut locations with a PAM site. For example, CRISPR/Cas9 with a guide sequence of ATGCTTACGTAGCTCCATGT could could bind18 KB (2,932 words) - 03:36, 2 November 2017
- {{Team:Hamburg/CSS}} <!--- {{Team:Hamburg/javascript/main}} --->19 KB (2,783 words) - 22:31, 14 December 2017
- ...e. Dimensions of a feature space depends on the scale of your dataset. For example, if you have twenty-six groups of data, you form a twenty-six dimensional f ...ng based logistic regression. From a high school IGEM participant's scope, team HFLS_H2Z will show you the difference between these models and the scope of18 KB (2,524 words) - 03:03, 2 November 2017
- ...t is basically a text document with some additional styling. The following example shows the minimal website:</p> ...the possibility to build your wiki page backbone in a way that your other team members cannot overwrite it by accident. We will cover how in the CSS secti18 KB (2,956 words) - 15:54, 23 September 2017
- ...s, it would be great to try and incorporate this into their treatment. For example if there is a farm which we know has a resistance problem <p>As a team we had previously never considered using PhagED as a powder to add to food,44 KB (7,119 words) - 03:42, 2 November 2017
- <p align="left">Create a page on your team wiki with clear attribution of each aspect of your project. This page must ...any other registered iGEM team in a meaningful way. For example, mentor a team, characterize a part, troubleshoot a project, model/simulate a system or va21 KB (3,342 words) - 02:19, 30 May 2017
- ...feedback that we provided for the Purdue Biomakers, please visit Purdue's team Wiki!</h4> ...? Discussing these points proved crucial in navigating our first year as a team, and Purdue's shared materials and discussions helped us greatly. </p><br>6 KB (986 words) - 13:50, 28 September 2017
- <p align="left">Create a page on your team wiki with clear attribution of each aspect of your project. This page must ...any other registered iGEM team in a meaningful way. For example, mentor a team, characterize a part, troubleshoot a project, model/simulate a system or va21 KB (3,342 words) - 17:16, 22 July 2017
- our project. The iGEM-team from Aachen of 2015 already built Do-It-Yourself peristaltic pumps based on The pumps of the 2015 team were designed for continuous pumping in a bioreactor, where they did a grea30 KB (4,195 words) - 00:12, 16 December 2017
- <!-- Remember the (Alamo) Template:Team:Dartmouth/etc --> {{Team:Dartmouth/DiGEM17_Style}}6 KB (810 words) - 04:29, 29 October 2017
- <li><a href="https://2017.igem.org/Team:Stony_Brook">Home</a></li> <a href="#">Team</a>11 KB (1,606 words) - 01:04, 2 November 2017
- {{:Team:Valencia_UPV/Templates:fonts}} {{:Team:Valencia_UPV/Templates:bootstrap}}41 KB (5,363 words) - 03:07, 2 November 2017
- <title> TEAM </title> ...). Also, some parts of the protocol were done in kit-like conditions. For example, steps for which liquids had to go through a silica membrane were done than28 KB (3,982 words) - 18:22, 29 October 2017
- The iGEM Team NAWI_Graz looked for different possibilities to collaborate with other team ...arlier, smaller version of the Giant Jamboree in Europe excited the whole team and we decided to send seven people to the Netherlands to get in touch with10 KB (1,513 words) - 03:02, 2 November 2017
- <li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...le="dropdown" href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team11 KB (1,569 words) - 22:03, 27 October 2017
- <title>Team:HFUT-China</title> <a href="https://2017.igem.org/Team:HFUT-China"> Main page </a>23 KB (2,323 words) - 01:11, 2 November 2017
- ...ology association organizes the Netherlands Biotechnology Conference. iGEM team Eindhoven, other iGEM teams and several other researchers were present to s ...an iGEM team presented ourselves to the students-to-be about iGEM and iGEM team Eindhoven. We did this to make them aware of the possibility to join future15 KB (2,567 words) - 17:17, 1 November 2017
- <li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...le="dropdown" href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team11 KB (1,572 words) - 21:54, 27 October 2017
- <li ><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...<li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team </a></li>9 KB (1,356 words) - 21:02, 25 October 2017
- <li ><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...<li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team </a></li>9 KB (1,357 words) - 21:10, 25 October 2017
- <li ><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...<li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team </a></li>9 KB (1,357 words) - 21:11, 25 October 2017
- <li ><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...<li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team </a></li>9 KB (1,344 words) - 03:47, 31 October 2017
- ...r"><em>Carlos Urzua, in colaboration with the iGEM team Groningen and iGEM team MIT</em></h4> ...number #26). We, at the Groningen team decided to collaborate with the MIT team by doing this analysis.</p>712 KB (88,923 words) - 16:59, 26 October 2017
- {{:Team:Valencia_UPV/Templates:fonts}} {{:Team:Valencia_UPV/Templates:bootstrap}}30 KB (3,986 words) - 08:32, 5 December 2017
- <a href='https://2017.igem.org/Team:NTNU_Trondheim'> <a href='https://2017.igem.org/Team:NTNU_Trondheim/Safety'>20 KB (2,075 words) - 03:13, 2 November 2017
- ...acuum. This year marked extensive development for mGEM’s Human Practices team, as we sought to address the gap between our project’s lab work and the t <p>The Human Practices team spoke with Dr. Dominik Mertz on August 2nd, 2017. Dr. Mertz is an associate33 KB (5,274 words) - 03:52, 2 November 2017
- <li><a href="https://2017.igem.org/Team:East_Chapel_Hill/Siyu">Home</a></li> ...le="dropdown" href="https://2017.igem.org/Team:East_Chapel_Hill/Team-Siyu">Team11 KB (1,567 words) - 21:49, 27 October 2017
- {{:Team:UChile OpenBio-CeBiB/Template/2}} {{:Team:UChile_OpenBio-CeBiB/Template/bg}}69 KB (10,880 words) - 03:57, 2 November 2017
- {{Team:TUST_China/TUST_meau}} {{Team:TUST_China/CSS/HP}}13 KB (1,387 words) - 02:41, 1 November 2017
- ...no-shadow" src="https://static.igem.org/mediawiki/2017/f/fb/Ionis-paris-hp-team.jpg"></img> ...no-shadow" src="https://static.igem.org/mediawiki/2017/f/fb/Ionis-paris-hp-team.jpg"></img>72 KB (9,335 words) - 00:52, 2 November 2017
- {{Example}} <p>This page is used by the judges to evaluate your team for the <a href="https://2017.igem.org/Judging/Medals">medal criterion</a>4 KB (610 words) - 18:59, 26 March 2018
- ...ic biology to the public. Although GMOs hold many possibilities in, for an example, future medication and fuels, we are also aware of the concerns regarding The team together with the volunteers. Photographer: Patrik Sanila17 KB (2,709 words) - 17:32, 8 December 2017
- <p>The expansion of mGEM’s Human Practices team this year allowed us the resources to integrate discussions of safety and r ...eatment process. This “standard” document helped to anchor the Wet Lab team in the current discovery climate, and revealed gaps (including efficiency a7 KB (1,096 words) - 03:49, 2 November 2017
- ...rom Iron(II) ion concentrations in saliva to amilCP concentrations for our team’s system. We first had to decide whether we should model our final cell-f ...f finding appropriate values for time, FURt and DNA become feasible. As an example, here is a graph of varying FURt values.</p><p><br></p><p>49 KB (7,597 words) - 23:23, 14 December 2017
- ...go. We also elaborated caps with logo for ZJU-China, our fellow collegiate team. ...tivity for children at Zhejiang Science and Technology Museum with another team from Zhejiang University. We designed various games and experiments which i25 KB (3,627 words) - 03:11, 2 November 2017
- {{Team:William_and_Mary/CSS_RESET}} {{Team:William_and_Mary/CSS_FIX}}13 KB (1,941 words) - 03:39, 2 November 2017
- {{:Team:NTHU_Taiwan/MenuBar}} ...out what the world lacks and to dedicate our ability to the needs. In our team, the cares of the environment and human health are the ultimate goals. The28 KB (4,286 words) - 16:11, 1 November 2017
- {{Team:Cadets2Vets/SideMenu}} <link href="https://2017.igem.org/Team:Cadets2Vets/css/common?action=raw&ctype=text/css" rel="stylesheet">101 KB (11,918 words) - 03:42, 1 November 2017
- {{Team:Lethbridge/assets/reset.css}} {{Team:Lethbridge/assets/sidemenuremove.css}}28 KB (4,404 words) - 23:49, 1 November 2017
- <title>2017.igem.org/Team:XMU-China/Project</title> <link href="https://2017.igem.org/Http://2017.igem.org/Team:XMU-China/css/unitcommomCss?action=raw&ctype=text/css" rel="stylesheet" typ7 KB (1,038 words) - 12:47, 27 October 2017
- {{:Team:Valencia_UPV/Templates:fonts}} {{:Team:Valencia_UPV/Templates:bootstrap}}24 KB (3,060 words) - 03:24, 2 November 2017
- ...rrey_GDA/HP/Silver">Silver</a> page and our <a href="https://2017.igem.org/Team:TecMonterrey_GDA/Project/Justification">Project Justification</a>.</p> <div class="p-2"><h4>1.- Formation of the team<h4></div>14 KB (2,347 words) - 03:31, 2 November 2017
- <h2><a href="https://2017.igem.org/Team:Macquarie_Australia"> Team Macquarie </a></h2> <p>Team Macquarie had constructed a hydrogenase gene capable of converting glucose12 KB (1,966 words) - 02:40, 2 November 2017
- <a href="https://2017.igem.org/Team:USTC" class="waves-effect waves-teal">Home</a> <li class="bg_all"><a href="https://2017.igem.org/Team:USTC/Description">Description</a></li>27 KB (2,696 words) - 13:00, 1 November 2017
- {{:Team:SUSTech_Shenzhen/removeStyles}} {{:Team:SUSTech_Shenzhen/themeCss}}8 KB (1,293 words) - 03:56, 2 November 2017
- {{:Team:SUSTech_Shenzhen/removeStyles}} {{:Team:SUSTech_Shenzhen/themeCss}}6 KB (975 words) - 02:00, 15 December 2017
- <link rel="stylesheet" href="https://2017.igem.org/Team:Dalhousie/libraries/css/Bootstrap?action=raw&ctype=text/css" /> <link rel="stylesheet" href="https://2017.igem.org/Team:Dalhousie/libraries/css/fonts?action=raw&ctype=text/css" />32 KB (4,612 words) - 03:57, 16 December 2017
- {{Team:TUST_China/TUST_meau}} {{Team:TUST_China/CSS/HP}}14 KB (1,587 words) - 00:20, 2 November 2017
- {{:Team:Tianjin/Templates/leftbar}} <link href="https://2017.igem.org/Team:Tianjin/Resources/CSS:maincss?action=raw&ctype=text/css52 KB (7,750 words) - 03:12, 2 November 2017
- {{:Team:York/Templates/NavigationBar}} ...0px;">As explained <a class="btn btn-default btn-xs" href="//2017.igem.org/Team:York/Background#DIHM" role="button" style="color:#000; border-color:#000";"29 KB (3,992 words) - 07:45, 31 October 2017
- ...on fields that would benefit from efficient enzymatic PET degradation. For example in PET recycling, the monomers produced could be used for synthesis of new <p>For example, recycling of mixed plastics and the purification of complex mixtures, resu24 KB (3,531 words) - 14:23, 30 October 2017
- {{:Team:Austin_UTexas_LASA/Templates/header}} <th><strong>Example</strong></th>56 KB (5,183 words) - 03:32, 2 November 2017
- ...t="_blank">CINDY Seq</a>), described on our <a href="https://2017.igem.org/Team:TUDelft/Measurement" target="_blank">measurement page</a>. In the process o ...ect via antigens. An indirect detection is the distinguishment between for example viral infections caused by the Zika and Dengue virus (<a href="#references"15 KB (2,290 words) - 21:12, 11 December 2017
- {{Example}} <p>Your team has been approved and you are ready to start the iGEM season! </p>4 KB (741 words) - 18:59, 26 March 2018
- Our team consists almost only of bachelor students from different courses as well as ...to his expertise and tips, we had been able to start a collaboration with Team Duesseldorf-Cologne.11 KB (1,567 words) - 02:01, 16 December 2017
- {{IISER-Pune-India/navbar|title=Team Roster|tl1=Unveiling the curtain! |tl2=IISER Pune India iGEM 2017 Wiki.}} <div class="title">The Team</div>12 KB (1,603 words) - 02:03, 2 November 2017
- ...; color: #888888; background-color: #eee;"> <a href="https://2017.igem.org/Team:TUDelft/mail/june" style="color:#888; text-decoration:underline; font-weigh33 KB (4,283 words) - 13:24, 7 August 2017
- ...; color: #888888; background-color: #eee;"> <a href="https://2017.igem.org/Team:TUDelft/mail/june" style="color:#888; text-decoration:underline; font-weigh33 KB (4,285 words) - 08:17, 27 July 2017
- ...; color: #888888; background-color: #eee;"> <a href="https://2017.igem.org/Team:TUDelft/mail/june" style="color:#888; text-decoration:underline; font-weigh33 KB (4,285 words) - 08:20, 27 July 2017
- {{Team:TUST_China/TUST_meau}} <h1>Team Introduction</h1>20 KB (2,146 words) - 14:40, 29 October 2017
- and is wrapped around the whole page content, except for the footer in this example --> As Newcastle iGEM team, we attended Big Bang with a few aims. Primarily, we wanted to spread knowl22 KB (3,517 words) - 17:35, 31 October 2017
- <div class="box2 right project" href="https://2017.igem.org/Team:TAS_Taipei/Background"> <div class="box2 right experiment" href="https://2017.igem.org/Team:TAS_Taipei/Experimental_Summary">33 KB (3,392 words) - 12:42, 1 November 2017
- <p>The wet lab team consisted of Yuchen Luo, Sakib Kazi, Setti Belhouri, and Jaycie Dalson. All <p>Shoumak Bhattacharya and Peter Doan helped the 2017 uOttawa team with mathematical models.</p>4 KB (657 words) - 13:17, 1 November 2017
- <center><h2 style=" font-size:24px ; " >Florida Atlantic Team</h2></center> ...le=" font-size:18px ; "><font face="monospace" color="#101337">The OwlGEMS team is a multidisciplinary group of graduate, undergraduate, and high school st13 KB (2,051 words) - 22:05, 1 November 2017
- {{:Team:Valencia_UPV/Templates:fonts}} {{:Team:Valencia_UPV/Templates:bootstrap}}27 KB (3,614 words) - 17:25, 6 December 2017
- ...of presentation slides and videos of 2016’s Giant Jamboree with Hokkaido team </li> <li><a href="#Taiwan2">5) The exchange of opinions with Taiwan team</a></li>6 KB (894 words) - 02:53, 2 November 2017
- document.getElementById("Team").style.display = "block"; document.getElementById("Team").style.display = "none";49 KB (5,847 words) - 21:35, 15 December 2017
- document.getElementById("Team").style.display = "block"; document.getElementById("Team").style.display = "none";38 KB (4,183 words) - 21:41, 15 December 2017
- <div class="collapse navbar-collapse" id="bs-example-navbar-collapse-1"> <li><a href="https://2017.igem.org/Team:FAFU-CHINA">Home</a></li>24 KB (3,341 words) - 02:40, 2 November 2017
- <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Team:DTU-Denmark/stylesheetsub?action=raw&ctype=text/css&?ver=6"> ...field we invited a high school student, Minh Greulich, to be a part of the team. <br><br>17 KB (2,484 words) - 03:06, 2 November 2017
- form_info.owner_type = "team"; ...r part). You may Check-In for as many organisms/parts as you wish, and any team member may send a Check-In at any time until the Jamboree.</p>19 KB (2,649 words) - 09:09, 26 June 2017
- form_info.owner_type = "team"; ...r part). You may Check-In for as many organisms/parts as you wish, and any team member may send a Check-In at any time until the Jamboree.</p>19 KB (2,643 words) - 17:56, 15 May 2017
- <a class="navbar-brand" href=https://2017.igem.org/Team:Szeged_SA_RMG> <button class="dropbtn">Team</button>11 KB (1,703 words) - 02:38, 2 November 2017
- <a href="https://2017.igem.org/Team:USTC" class="waves-effect waves-teal">Home</a> <li class="bg_all"><a href="https://2017.igem.org/Team:USTC/Description">Description</a></li>20 KB (2,420 words) - 03:53, 2 November 2017
- {{:Team:UNOTT/Template/NavBarTest}} ...ing to make sure that we were sure about our project. We went bowling as a team this week and discovered that Natalia is an incredibly precise bowler... ho30 KB (4,731 words) - 13:46, 28 October 2017
- <a href="https://2017.igem.org/Team:Aalto-Helsinki/HP/Silver">Silver</a><br> <a style="text-decoration: underline;" href="https://2017.igem.org/Team:Aalto-Helsinki/HP/Gold_Integrated">Integrated Human Practices</a><br>24 KB (3,772 words) - 07:32, 13 December 2017
- <li> <b>Be an example for others. </b> Consider what you can do to help other teams reuse and ada ...ity. For this prize, activities do not have to be directly related to your team's project (as is expected for the Integrated Human Practices prize and gold8 KB (1,355 words) - 19:20, 16 October 2017
- {{:Team:Sydney_Australia/Templates/NavBar}} ...ch the conclusion we have, please visit our <a href="https://2017.igem.org/Team:Sydney_Australia/HP/Gold_Integrated">Integrated Human Practices Page</a>. V74 KB (10,273 words) - 11:42, 30 November 2017
- {{Team:UCL/Bootstrap}} {{Team:UCL/CSS}}22 KB (2,447 words) - 23:54, 1 November 2017
- ...om the Patch Clamp showing indeed a change in frequency of the rhythm, the team started looking at the future. We started brainstorming about the theoretic <h3><a href="https://2017.igem.org/Team:KU_Leuven/Protocols">Patch Clamp</a></h3>139 KB (14,882 words) - 03:56, 2 November 2017
- <strong>Literature example:</strong> - <br> <strong>Literature example:</strong> (4) <br>10 KB (1,330 words) - 23:28, 1 November 2017
- .Survey .Example .Headline{ width: 700px;} .Survey .Example .img{ width: 1200px; margin-bottom: 100px;}5 KB (646 words) - 10:01, 29 October 2017
- <p>This experiment was one of the first to be completed by our team in the Li lab. That being said, the purpose of this experiment was to visua <td>Calculated by example:90.4 uM</td>57 KB (8,964 words) - 08:08, 21 November 2017
- <p>This page is used by the judges to evaluate your team for the <a href="https://2017.igem.org/Judging/Medals">medal criterion</a> ...including the host labs, advisors, instructors, and individuals not on the team roster.4 KB (610 words) - 21:05, 22 March 2017
- <div class="title_extra" > Team Requirements </div> <h4> Each team can only compete in one track.</h4>8 KB (1,227 words) - 19:15, 16 October 2017
- ..."#"><img src="https://static.igem.org/mediawiki/2017/9/9c/T--TU-Eindhoven--Team.png" width="128" height="60" alt="Team_Icon" /></a></li> <h2>March - Building the Team</h2>34 KB (5,513 words) - 17:18, 1 November 2017
- {{:Team:SUSTech_Shenzhen/removeStyles}} {{:Team:SUSTech_Shenzhen/nav}}<!--------子页面导航栏-------------------------30 KB (3,996 words) - 16:46, 14 December 2017
- <meta http-equiv="refresh" content="0; url=https://2017.igem.org/Team:TU_Darmstadt/judging/attributions"></meta> <p>This page is used by the judges to evaluate your team for the <a href="https://2017.igem.org/Judging/Medals">medal criterion</a>4 KB (622 words) - 15:15, 24 October 2017
- {{Team:Queens_Canada/QU17_Menu}} {{Team:Queens_Canada/QU17_Style}}9 KB (1,304 words) - 01:07, 2 November 2017
- <title>Team</title> <script src="https://2017.igem.org/wiki/index.php?title=Team:USTC-Software/js/jquery&action=raw&ctype=text/javascript" type="text/javasc11 KB (1,060 words) - 02:56, 2 November 2017
- <li><a href="https://2017.igem.org/Team:Wageningen_UR">Home</a></li> <li><a href="https://2017.igem.org/Team:Wageningen_UR/Human_Practices">Human Practices</a></li>11 KB (1,352 words) - 17:10, 1 November 2017
- .team #team_link, <li id="header_navbar_home"><a href="https://2017.igem.org/Team:Chalmers-Gothenburg" id="home_link"> Home </a></li>275 KB (38,733 words) - 17:01, 30 October 2017
- <a href='https://2017.igem.org/Team:NTNU_Trondheim'> <a href='https://2017.igem.org/Team:NTNU_Trondheim/Safety'>20 KB (1,933 words) - 03:11, 2 November 2017
- <li class="active"><a href="https://2017.igem.org/Team:East_Chapel_Hill">Home</a></li> <a href="https://2017.igem.org/Team:East_Chapel_Hill/Team">Team </a>7 KB (964 words) - 02:32, 18 October 2017
- <link rel="stylesheet" href="https://2017.igem.org/Team:Dalhousie/libraries/css/Bootstrap?action=raw&ctype=text/css" /> <link rel="stylesheet" href="https://2017.igem.org/Team:Dalhousie/libraries/css/fonts?action=raw&ctype=text/css" />11 KB (1,356 words) - 17:33, 18 October 2017
- <link rel="stylesheet" href="https://2017.igem.org/Team:Dalhousie/libraries/css/Bootstrap?action=raw&ctype=text/css" /> <link rel="stylesheet" href="https://2017.igem.org/Team:Dalhousie/libraries/css/fonts?action=raw&ctype=text/css" />11 KB (1,356 words) - 17:34, 18 October 2017
- <link rel="stylesheet" href="https://2017.igem.org/Team:Dalhousie/libraries/css/Bootstrap?action=raw&ctype=text/css" /> <link rel="stylesheet" href="https://2017.igem.org/Team:Dalhousie/libraries/css/fonts?action=raw&ctype=text/css" />11 KB (1,356 words) - 17:34, 18 October 2017
- <link href='https://2017.igem.org/Team:ZJU-China/cs/font?action=raw&ctype=text/css' rel='stylesheet' type='text/cs <a href="https://2017.igem.org/Team:ZJU-China">41 KB (5,164 words) - 00:07, 2 November 2017
- <p>This page is used by the judges to evaluate your team for the <a href="https://2017.igem.org/Judging/Medals">medal criterion</a> ...including the host labs, advisors, instructors, and individuals not on the team roster.4 KB (605 words) - 01:34, 27 October 2017
- ...then expressed interest in attending another camp and in joining the iGEM team as high schoolers! Through the results of our camp, we discovered that synt ...r camp and other education events (including pictures) under the <a href="/Team:CCA_San_Diego/Engagement">Education & Public Engagement page.</a></h6><br>16 KB (2,444 words) - 04:04, 19 November 2017
- ...navbar-logo" src="https://static.igem.org/mediawiki/2017/4/4e/T--Peshawar--Team-Logo.png" alt="iGEM Peshawar"></a> <a href="https://2017.igem.org/Team:Peshawar">Home</a>22 KB (2,760 words) - 20:41, 14 December 2017
- ...<li><a class="Link-pg" style="padding: 0 1em;" href="https://2017.igem.org/Team:Amazonas_Brazil"><img src="https://static.igem.org/mediawiki/2017/d/d4/T--A <li><a class="bar_text" href="https://2017.igem.org/Team:Amazonas_Brazil/Human_Practices">Overview</a></li>18 KB (2,622 words) - 03:53, 2 November 2017
- <h5>For the iGEM 2017 season, High School will be a team "kind", section, and track. It is important to understand these distinction <h3>High School as a team "kind"</h3>5 KB (859 words) - 00:25, 16 December 2016
- <ul><li>Understand how the genetic toggle switch works as an example of a synthetic biology system</li><li>Interpret a model of the circuit for ...fine our activities after each summer school session <b>(Table 1)</b>. For example, we converted the TinkerCell computer based bacterial photography system ac24 KB (3,596 words) - 03:30, 2 November 2017
- ...or Goal by reminding the viewer of certain facts established elsewhere. An example is provided in Figure 2. If a Strategy is “Argument over kill-switch part ...rts they use are characterized and how they might interact. In order for a team to use a BioBrick in its project, the Environment and Organism included in18 KB (2,858 words) - 03:52, 2 November 2017
- <li><a href="https://2017.igem.org/Team:Wageningen_UR">Home</a></li> <li><a href="https://2017.igem.org/Team:Wageningen_UR/Human_Practices">Human Practices</a></li>31 KB (3,630 words) - 22:35, 1 November 2017
- {{Team:Bielefeld-CeBiTec/Head}} {{Team:Bielefeld-CeBiTec/Header}}10 KB (1,616 words) - 17:57, 24 October 2017
- {{:Team:AHUT_China/Template/CSS_RESET}} ...n" class="navbar-toggle collapsed" data-toggle="collapse" data-target="#bs-example-navbar-collapse-1" aria-expanded="false">19 KB (2,526 words) - 03:50, 2 November 2017
- <title>Team:HFUT-China</title> <a href="https://2017.igem.org/Team:HFUT-China"> Main page </a>21 KB (2,248 words) - 02:38, 2 November 2017
- {{Team:Calgary/BasicPage ...as a way to process the solid remains from <a href="https://2017.igem.org/Team:Calgary/SolidLiquidSeparation ">solid-liquid separation </a>. The advantage17 KB (2,608 words) - 03:08, 2 November 2017
- {{Team:BostonU_Hardware/CSS}} ...t" style="margin:0px 50px 0px 50px">On July 12th 2017 the BostonU Hardware team was able to participate in Summer Pathways, an event organized by STEM Path15 KB (2,125 words) - 16:23, 30 November 2017
- {{Example}} <p>This page is used by the judges to evaluate your team for the <a href="https://2017.igem.org/Judging/Medals">medal criterion</a>2 KB (411 words) - 18:59, 26 March 2018
- ...its nature - is it inherently good or bad? The Technion, a fellow Israeli team, published an ethics booklet with a focus on synthetic biology and it was t ...ept of the sanctity of life. Please see our <a href="https://2017.igem.org/Team:Tel-Hai/HP/Silver">human practice page</a> for a more detailed discussion o8 KB (1,279 words) - 12:24, 30 October 2017
- ...d developing countries produce massive amounts of food waste (Fig. 1). For example, in China, the most densely populated country, the food waste reaches a str <p class="my-content" >Focusing on the issue of food waste, our team analyses the current disposal methods, trying to look for the best solution15 KB (2,272 words) - 13:20, 1 November 2017
- {{Template:Team:Potsdam/Header}} ...metabolic pathway the yield of this pathway may be increased. This was for example investigated for the indole-3-acetic acid pathway using a transcription act32 KB (4,525 words) - 10:59, 1 November 2017