Alma.chapet (Talk | contribs) |
|||
(55 intermediate revisions by 4 users not shown) | |||
Line 21: | Line 21: | ||
} | } | ||
.sequencetable { | .sequencetable { | ||
− | |||
− | |||
} | } | ||
.sequencecell { | .sequencecell { | ||
− | + | max-width : 200px; !important; | |
} | } | ||
.partnamecell { | .partnamecell { | ||
− | + | width : 200px; !important; | |
+ | } | ||
+ | .partlinkcell { | ||
+ | width : 100px !important; | ||
+ | } | ||
+ | .partsizecell { | ||
+ | width : 50px !important; | ||
} | } | ||
</style> | </style> | ||
Line 39: | Line 43: | ||
<h1>Introduction & Background </h1> | <h1>Introduction & Background </h1> | ||
− | <div class=text1>For our main system to work, where production of a biomaterial | + | <div class=text1>For our main system to work, where production of a biomaterial only occurs when two specific lights intersect, a logic-gate needed to be developed. To create a NOR-gate at the promoter level, we aimed to create dually repressed promoters. Most of NOR-gate promoter designs using tandem repressible promoters have unpredictable properties and leaky expression. The main challenge was to create a clean design of NOR-gate containing only one transcription starting point. One main issue with such a design is the lack of standard transcriptional elements smaller than repressible promoters. Recent work on transcription elements showed that assembling insulated synthetic operator upstream and downstream of an insulated T7 promoter core allowed for a more diverse control of gene expression and a more specific response time (1).</div> |
<div class="divseparator"></div> | <div class="divseparator"></div> | ||
+ | |||
<h1>Design</h1> | <h1>Design</h1> | ||
− | |||
<div class=text2> | <div class=text2> | ||
Line 50: | Line 54: | ||
<b>A</b> - Only one copy of each repressor is present downstream of the promoter core. | <b>A</b> - Only one copy of each repressor is present downstream of the promoter core. | ||
B - A copy of one of the two different operators is present upstream of the promoter core to possibly enable a better control of gene expression. | B - A copy of one of the two different operators is present upstream of the promoter core to possibly enable a better control of gene expression. | ||
− | </span></div> | + | </span></br></br> |
+ | </div> | ||
− | + | <div class=text2right>Based on our <a href=”https://2017.igem.org/Team:Paris_Bettencourt/Model#thirdmodel”>modeling</a> results, we decided to work of three specific repressors due to their interesting parameter values. For each pair of repressors, four different arrangements of the operators were characterized experimentally. Firstly, the impact of the way the two operators are ordered downstream of the promoter core was studied (Figure 2A). Secondly, we studied the impact of adding a second operator upstream of the promoter core on promoter activity (Figure 2B). This gave us a total of twelve promoters to test (Table 1). </div> | |
− | + | ||
</div> | </div> | ||
− | <div class= | + | <div class=text6>Table 1: Dually repressible promoters designed for this study</div> |
+ | <div class=text2><div class=text2left> | ||
<table class=sequencetable> | <table class=sequencetable> | ||
− | <tr> <th>Part number</th><th>Part Name</th><th>Sequence</th><th>Size</th></tr> | + | <tr> <th class=partlinkcell>Part number</th><th>Part Name</th><th>Sequence</th><th class=partsizecell>Size</th></tr> |
− | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510018">BBa_K2510018</a></td><td class=partnamecell>T7 - O-HKcI - O-P22c2 promoter</td><td class=sequencecell> | + | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510018">BBa_K2510018</a></td><td class=partnamecell>T7 - O-HKcI - O-P22c2 promoter</td><td class=sequencecell>GTAATACGACTCACTATAGGGGTGAACCATAAGTTCAGCTCTGATTTAAGTGTTCTTTAATCGCTGTTCCGCTG</td><td>74</td></tr> |
− | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510019">BBa_K2510019</a></td><td class=partnamecell>T7 - O-HKcI - O-TetR promoter</td><td class=sequencecell> | + | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510019">BBa_K2510019</a></td><td class=partnamecell>T7 - O-HKcI - O-TetR promoter</td><td class=sequencecell>GTAATACGACTCACTATAGGGGTGAACCATAAGTTCAGCTCTGTCCCTATCAGTGATAGAGATCACACTCCTTC</td><td>74</td></tr> |
− | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510020">BBa_K2510020</a></td><td class=partnamecell>T7 - O-P22c2 - O-HKcI promoter</td><td class=sequencecell> | + | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510020">BBa_K2510020</a></td><td class=partnamecell>T7 - O-P22c2 - O-HKcI promoter</td><td class=sequencecell>GTAATACGACTCACTATAGGGGATTTAAGTGTTCTTTAATCGCTGTTCCGCTGTGAACCATAAGTTCAGCTCTG</td><td>74</td></tr> |
− | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510021">BBa_K2510021</a></td><td class=partnamecell>T7 - O-P22c2 - O-TetR promoter</td><td class=sequencecell> | + | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510021">BBa_K2510021</a></td><td class=partnamecell>T7 - O-P22c2 - O-TetR promoter</td><td class=sequencecell>GTAATACGACTCACTATAGGGGATTTAAGTGTTCTTTAATCGCTGTTCCGCTGTCCCTATCAGTGATAGAGATCACACTCCTTC</td><td>84</td></tr> |
− | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510022">BBa_K2510022</a></td><td class=partnamecell>T7- O-TetR - O-HKcI promoter</td><td class=sequencecell> | + | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510022">BBa_K2510022</a></td><td class=partnamecell>T7- O-TetR - O-HKcI promoter</td><td class=sequencecell>GTAATACGACTCACTATAGGGGTCCCTATCAGTGATAGAGATCACACTCCTTCTGAACCATAAGTTCAGCTCTG</td><td>74</td></tr> |
− | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510023">BBa_K2510023</a></td><td class=partnamecell>T7 - O-TetR - O-P22c2 promoter</td><td class=sequencecell> | + | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510023">BBa_K2510023</a></td><td class=partnamecell>T7 - O-TetR - O-P22c2 promoter</td><td class=sequencecell>GTAATACGACTCACTATAGGGGTCCCTATCAGTGATAGAGATCACACTCCTTCATTTAAGTGTTCTTTAATCGCTGTTCCGCTG</td><td>84</td></tr> |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
</table> | </table> | ||
− | |||
</div> | </div> | ||
+ | <div class=text2right> | ||
+ | <table> | ||
+ | <tr> <th class=partlinkcell>Part number</th><th>Part Name</th><th>Sequence</th><th class=partsizecell>Size</th></tr> | ||
+ | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510024">BBa_K2510024</a></td><td class=partnamecell>O-HKcI - T7 - O-HKcI - O-P22c2 promoter</td><td class=sequencecell>GTGAACCATAAGTTCAGCTATGTAATACGACTCACTATAGGGGTGAACCATAAGTTCAGCTCTGATTTAAGTGTTCTTTAATCG CTGTTCCGCTG</td><td>95</td></tr> | ||
+ | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510025">BBa_K2510025</a></td><td class=partnamecell>O-HKcI - T7 - O-HKcI - O-TetR promoter</td><td class=sequencecell>GTGAACCATAAGTTCAGCTATGTAATACGACTCACTATAGGGGTGAACCATAAGTTCAGCTCTGTCCCTATCAGTGATAGAGAT CACACTCCTTC</td><td>95</td></tr> | ||
+ | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510026">BBa_K2510026</a></td><td class=partnamecell>O-P22C2 - T7 - O-P22C2 - O-HKcI promoter</td><td class=sequencecell>GTCATTTAAGTGTTCTTTAATGAGCATCTGCTATGTAATACGACTCACTATAGGGGATTTAAGTGTTCTTTAATCGCTGTTCCGCTGTGAACCATAAGTTCAGCTCTG</td><td>107</td></tr> | ||
+ | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510027">BBa_K2510027</a></td><td class=partnamecell>O-P22c2 - T7 - O-P22C2 - O-TetR promoter</td><td class=sequencecell>GTCATTTAAGTGTTCTTTAATGAGCATCTGCTATGTAATACGACTCACTATAGGGGATTTAAGTGTTCTTTAATCGCTGTTCCG CTGTCCCTATCAGTGATAGAGATCACACTCCTTC</td><td>118</td></tr> | ||
+ | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510028">BBa_K2510028</a></td><td class=partnamecell>O-TetR - T7 - O-TetR - O-HKcI promoter</td><td class=sequencecell>GTCTCCCTATCAGTGATAGAGATCACACTCCTTCAACCTATGTAATACGACTCACTATAGGGGTCCCTATCAGTGATAGAGATC ACACTCCTTCTGAACCATAAGTTCAGCTCTG</td><td>115</td></tr> | ||
+ | <tr> <td><a target="_blank" href="http://parts.igem.org/wiki/index.php?title=Part:BBa_K2510029">BBa_K2510029</a></td><td class=partnamecell>O-TetR - T7 - O-TetR - O-P22C2 promoter</td><td class=sequencecell>GTCTCCCTATCAGTGATAGAGATCACACTCCTTCAACCTATGTAATACGACTCACTATAGGGGTCCCTATCAGTGATAGAGATC ACACTCCTTCATTTAAGTGTTCTTTAATCGCTGTTCCGCTG</td><td>125</td></tr></table></div></div> | ||
+ | <div class=text2><div class=text2left><img src="https://static.igem.org/mediawiki/2017/f/f2/Fig2_LC_PB.png"><span><b>Figure 2</b>: Design of repressor expression device and reporter. <b>A</b> - First repressor and reporter regulated by P<sub>lacI</sub><b>B</b> - Second reporter and repressor regulated by P<sub>Bad</sub></span></div> | ||
+ | <div class=text2right>Different input combinations were applied to the system, i.e. repressor concentrations were varied. In order to control concentration, the repressors were put under the control of well-known inducible promoters : p<sub>lacI</sub> and p<sub>ara</sub>. Since it is difficult to track the concentration of each repressor in real time, We designed the system presented in Figure 2 to be able to track repressor concentration using simple fluorescence. </div></div> | ||
− | |||
− | < | + | <h1><i>In vivo</i> testing</h1> |
+ | <div class=text2><div class="text2left">Testing of the promoters was performed <i>in vivo</i> in <i>E. coli</i> BL21 (AI) and <i>E. coli</i> BL21 (DE3). Both strains were tested to counter the effect of the T7 polymerase and at least one of the repressors being regulated by the same promoter. Analysis of fluorescence using a flow cytometer, testing four conditions for each strain: no inducer, each inducer individually - IPTG and arabinose - and both inducers together. The testing was performed on strains containing or not the repressors gene. The output measured is mRFP1 fluorescence and inputs ,<i>i.e.</i> repressor concentrations, are approximated by the concentration in fluorescent reporter protein - eyfp or ecfp. All florescences were measured using a flow cytometer. | ||
+ | </div> | ||
+ | <div class="text2right"> | ||
+ | <table> | ||
+ | <thead> | ||
+ | <tr> | ||
+ | <th ></th> | ||
+ | <th >Strain</th> | ||
+ | <th >Contains</th> | ||
+ | <th>Conditions</th> | ||
+ | </tr> | ||
+ | </thead> | ||
+ | <tbody> | ||
+ | <tr> | ||
+ | <th >Bx</th> | ||
+ | <td >BL21 (DE3)</td> | ||
+ | <td >Only promoters</td> | ||
+ | <td>No inducer</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="3"></td> | ||
+ | <td>0.2% arabinose</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="3"></td> | ||
+ | <td>1mM IPTG</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="3"></td> | ||
+ | <td>1 mM IPTG + 0.2% arabinose</td> | ||
+ | </tr> | ||
+ | |||
+ | |||
+ | |||
+ | <tr> | ||
+ | <th >Cx</th> | ||
+ | <td >BL21 (AI)</td> | ||
+ | <td >Repressor genes and promoters</td> | ||
+ | <td>No inducer</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="3"></td> | ||
+ | <td>0.2% arabinose</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="3"></td> | ||
+ | <td>1mM IPTG</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="3"></td> | ||
+ | <td>1 mM IPTG + 0.2% arabinose</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <th >Dx</th> | ||
+ | <td >BL21 (DE3)</td> | ||
+ | <td >Repressor genes and promoters</td> | ||
+ | <td>No inducer</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="3"></td> | ||
+ | <td>0.2% arabinose</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="3"></td> | ||
+ | <td>1mM IPTG</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td colspan="3"></td> | ||
+ | <td>1 mM IPTG + 0.2% arabinose</td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | </div></div> | ||
+ | |||
+ | <img src=""> | ||
+ | |||
+ | <div class=text5><div class="text5left">The data obtained from our flow cytometry analysis was analysed. Figure 5 shows that the behavior of promoters is not as predictible as our model showed. Because we are working in a system where the presence of inducer both activates the expression of the T7 polymerase and the repressor, the data can prove difficult to analyse. However, certain promoters present the expected behavior and show higher expression when the inducer is administered. However, the effect of the T7 polymerase induction vs the induction of the repressors remains unclear. Such results seem to show that the insularity of the promoter elements should be put in question for the design more complex genetic structures. </div> | ||
+ | <div class="text5right"><img src="https://static.igem.org/mediawiki/2017/f/fd/FACS_analysis_PB.png"><span><b>Figure 5</b>: Data obtained from flow cytometry experiments. The number showed is the mean of medians for 3 different experiments.</span></div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | <h1>Cell-free testing using Photocaged repressors</h1> | ||
+ | |||
+ | <div class=text2><div class="text2left">We wanted to combine two aspects of our project: our designed logic gate and the <a href="https://2017.igem.org/Team:Paris_Bettencourt/Proteins_Caging">photocaged repressors</a>. We chose to test them in a cell-free environment for both practicality reasons and to show that every aspect of our project was compatible with a cell-free environment. Using the NEB PURExpress kit for protein expression, we tested the impact of repressor caging on promoter activity. Violet light leads to the monomerization of Dronpa, so it releases the repressor, whereas Cyen light should leads to its dimerization, <i>i.e.</i> the caging of the repressor. </br></br> | ||
+ | We expected to observe no red fluorescence after exposure to violet light and fluorescence after exposure to cyan light, as we thought the system would work similarly to a non-caged repressor. However, it appears that the fluorescence levels are increased over 1000-fold when the repressor is not caged.</br></br> | ||
+ | One explanation for this behavior could be that the dimerization of Dronpa, instead of preventing repressor binding to its operator, actually makes it's binding more permanent, thus leading to the lower fluorescence level. | ||
+ | </div> | ||
+ | <div class="text2right"><img src="https://static.igem.org/mediawiki/2017/e/e2/Logic_tetR_PB.png"></br><img src="https://static.igem.org/mediawiki/2017/8/8e/Logic_P22c2_PB.png"></br><img src="https://static.igem.org/mediawiki/2017/1/19/Logic_HKcIfigure_PB.png"></br><span><b>Figure 4</b>: Results of the cell-free experiment. Each promoter was tested with its cognate repressors. <b>Top</b>: Testing with TetR caged with either wt-Dronpa (BBa_K2510108) or a mutated version(BBa_K2510109)<b>Middle</b>: Testing with P22c2 caged with either wt-Dronpa (BBa_K2510112) or a mutated version(BBa_K2510113).<b>Bottom</b>: Testing with HKcI caged with either wt-Dronpa (BBa_K2510110) or a mutated version(BBa_K2510111)</div> | ||
+ | |||
+ | |||
+ | |||
+ | </div> | ||
+ | |||
+ | |||
+ | </div> | ||
+ | |||
+ | </div> | ||
</div> | </div> |
Latest revision as of 03:22, 2 November 2017
LOGIC CIRCUIT
Introduction & Background
For our main system to work, where production of a biomaterial only occurs when two specific lights intersect, a logic-gate needed to be developed. To create a NOR-gate at the promoter level, we aimed to create dually repressed promoters. Most of NOR-gate promoter designs using tandem repressible promoters have unpredictable properties and leaky expression. The main challenge was to create a clean design of NOR-gate containing only one transcription starting point. One main issue with such a design is the lack of standard transcriptional elements smaller than repressible promoters. Recent work on transcription elements showed that assembling insulated synthetic operator upstream and downstream of an insulated T7 promoter core allowed for a more diverse control of gene expression and a more specific response time (1).
Design
Figure 1: Design of the system to test dually repressible promoters. Each promoter is composed of at least two different operators (in blue) recognized by specific repressors and regulates the expression of a reporter gene (mRFP1 in red).
A - Only one copy of each repressor is present downstream of the promoter core.
B - A copy of one of the two different operators is present upstream of the promoter core to possibly enable a better control of gene expression.
Based on our modeling results, we decided to work of three specific repressors due to their interesting parameter values. For each pair of repressors, four different arrangements of the operators were characterized experimentally. Firstly, the impact of the way the two operators are ordered downstream of the promoter core was studied (Figure 2A). Secondly, we studied the impact of adding a second operator upstream of the promoter core on promoter activity (Figure 2B). This gave us a total of twelve promoters to test (Table 1).
Table 1: Dually repressible promoters designed for this study
Part number | Part Name | Sequence | Size |
---|---|---|---|
BBa_K2510018 | T7 - O-HKcI - O-P22c2 promoter | GTAATACGACTCACTATAGGGGTGAACCATAAGTTCAGCTCTGATTTAAGTGTTCTTTAATCGCTGTTCCGCTG | 74 |
BBa_K2510019 | T7 - O-HKcI - O-TetR promoter | GTAATACGACTCACTATAGGGGTGAACCATAAGTTCAGCTCTGTCCCTATCAGTGATAGAGATCACACTCCTTC | 74 |
BBa_K2510020 | T7 - O-P22c2 - O-HKcI promoter | GTAATACGACTCACTATAGGGGATTTAAGTGTTCTTTAATCGCTGTTCCGCTGTGAACCATAAGTTCAGCTCTG | 74 |
BBa_K2510021 | T7 - O-P22c2 - O-TetR promoter | GTAATACGACTCACTATAGGGGATTTAAGTGTTCTTTAATCGCTGTTCCGCTGTCCCTATCAGTGATAGAGATCACACTCCTTC | 84 |
BBa_K2510022 | T7- O-TetR - O-HKcI promoter | GTAATACGACTCACTATAGGGGTCCCTATCAGTGATAGAGATCACACTCCTTCTGAACCATAAGTTCAGCTCTG | 74 |
BBa_K2510023 | T7 - O-TetR - O-P22c2 promoter | GTAATACGACTCACTATAGGGGTCCCTATCAGTGATAGAGATCACACTCCTTCATTTAAGTGTTCTTTAATCGCTGTTCCGCTG | 84 |
Part number | Part Name | Sequence | Size |
---|---|---|---|
BBa_K2510024 | O-HKcI - T7 - O-HKcI - O-P22c2 promoter | GTGAACCATAAGTTCAGCTATGTAATACGACTCACTATAGGGGTGAACCATAAGTTCAGCTCTGATTTAAGTGTTCTTTAATCG CTGTTCCGCTG | 95 |
BBa_K2510025 | O-HKcI - T7 - O-HKcI - O-TetR promoter | GTGAACCATAAGTTCAGCTATGTAATACGACTCACTATAGGGGTGAACCATAAGTTCAGCTCTGTCCCTATCAGTGATAGAGAT CACACTCCTTC | 95 |
BBa_K2510026 | O-P22C2 - T7 - O-P22C2 - O-HKcI promoter | GTCATTTAAGTGTTCTTTAATGAGCATCTGCTATGTAATACGACTCACTATAGGGGATTTAAGTGTTCTTTAATCGCTGTTCCGCTGTGAACCATAAGTTCAGCTCTG | 107 |
BBa_K2510027 | O-P22c2 - T7 - O-P22C2 - O-TetR promoter | GTCATTTAAGTGTTCTTTAATGAGCATCTGCTATGTAATACGACTCACTATAGGGGATTTAAGTGTTCTTTAATCGCTGTTCCG CTGTCCCTATCAGTGATAGAGATCACACTCCTTC | 118 |
BBa_K2510028 | O-TetR - T7 - O-TetR - O-HKcI promoter | GTCTCCCTATCAGTGATAGAGATCACACTCCTTCAACCTATGTAATACGACTCACTATAGGGGTCCCTATCAGTGATAGAGATC ACACTCCTTCTGAACCATAAGTTCAGCTCTG | 115 |
BBa_K2510029 | O-TetR - T7 - O-TetR - O-P22C2 promoter | GTCTCCCTATCAGTGATAGAGATCACACTCCTTCAACCTATGTAATACGACTCACTATAGGGGTCCCTATCAGTGATAGAGATC ACACTCCTTCATTTAAGTGTTCTTTAATCGCTGTTCCGCTG | 125 |
Figure 2: Design of repressor expression device and reporter. A - First repressor and reporter regulated by PlacIB - Second reporter and repressor regulated by PBad
Different input combinations were applied to the system, i.e. repressor concentrations were varied. In order to control concentration, the repressors were put under the control of well-known inducible promoters : placI and para. Since it is difficult to track the concentration of each repressor in real time, We designed the system presented in Figure 2 to be able to track repressor concentration using simple fluorescence.
In vivo testing
Testing of the promoters was performed in vivo in E. coli BL21 (AI) and E. coli BL21 (DE3). Both strains were tested to counter the effect of the T7 polymerase and at least one of the repressors being regulated by the same promoter. Analysis of fluorescence using a flow cytometer, testing four conditions for each strain: no inducer, each inducer individually - IPTG and arabinose - and both inducers together. The testing was performed on strains containing or not the repressors gene. The output measured is mRFP1 fluorescence and inputs ,i.e. repressor concentrations, are approximated by the concentration in fluorescent reporter protein - eyfp or ecfp. All florescences were measured using a flow cytometer.
Strain | Contains | Conditions | |
---|---|---|---|
Bx | BL21 (DE3) | Only promoters | No inducer |
0.2% arabinose | |||
1mM IPTG | |||
1 mM IPTG + 0.2% arabinose | |||
Cx | BL21 (AI) | Repressor genes and promoters | No inducer |
0.2% arabinose | |||
1mM IPTG | |||
1 mM IPTG + 0.2% arabinose | |||
Dx | BL21 (DE3) | Repressor genes and promoters | No inducer |
0.2% arabinose | |||
1mM IPTG | |||
1 mM IPTG + 0.2% arabinose |
The data obtained from our flow cytometry analysis was analysed. Figure 5 shows that the behavior of promoters is not as predictible as our model showed. Because we are working in a system where the presence of inducer both activates the expression of the T7 polymerase and the repressor, the data can prove difficult to analyse. However, certain promoters present the expected behavior and show higher expression when the inducer is administered. However, the effect of the T7 polymerase induction vs the induction of the repressors remains unclear. Such results seem to show that the insularity of the promoter elements should be put in question for the design more complex genetic structures.
Figure 5: Data obtained from flow cytometry experiments. The number showed is the mean of medians for 3 different experiments.
Cell-free testing using Photocaged repressors
We wanted to combine two aspects of our project: our designed logic gate and the photocaged repressors. We chose to test them in a cell-free environment for both practicality reasons and to show that every aspect of our project was compatible with a cell-free environment. Using the NEB PURExpress kit for protein expression, we tested the impact of repressor caging on promoter activity. Violet light leads to the monomerization of Dronpa, so it releases the repressor, whereas Cyen light should leads to its dimerization, i.e. the caging of the repressor.
We expected to observe no red fluorescence after exposure to violet light and fluorescence after exposure to cyan light, as we thought the system would work similarly to a non-caged repressor. However, it appears that the fluorescence levels are increased over 1000-fold when the repressor is not caged.
One explanation for this behavior could be that the dimerization of Dronpa, instead of preventing repressor binding to its operator, actually makes it's binding more permanent, thus leading to the lower fluorescence level.
Figure 4: Results of the cell-free experiment. Each promoter was tested with its cognate repressors. Top: Testing with TetR caged with either wt-Dronpa (BBa_K2510108) or a mutated version(BBa_K2510109)Middle: Testing with P22c2 caged with either wt-Dronpa (BBa_K2510112) or a mutated version(BBa_K2510113).Bottom: Testing with HKcI caged with either wt-Dronpa (BBa_K2510110) or a mutated version(BBa_K2510111)