Team:Heidelberg/RFC

iGEM TEAM HEIDELBERG 2017

---

COLLAPSE NAVIGATION

---

• People
  • Team
  • Attributions
  • Sponsoring
  • For Judges
  • Giant Jamboree
• Project
  • Overview
  • Background & Design
  • PACE
  • PREDCEL
  • Results Summary
  • Software Validation
  • Organosilicons
  • Protein Interaction
  • Cytochrome Engineering
  • Optogenetics
  • CRISPR Cas9
  • InterLab Study
  • Achievements
• Parts
  • Overview
  • Basic Parts
  • Composite Parts
  • Improved Part
  • Parts Collection
  • Part List
  • RFC
• Modeling
  • Overview
  • Phage Titer
  • Mutagenesis Induction
  • Mutation Rate Estimation
  • Lagoon Contamination
  • Medium Consumption
  • Interactive Web Tools
• Software
  • AiGEM Overview
  • DeeProtein
  • GAIA
  • SafetyNet
  • MAWS 2.0
• Human Practices
  • Overview
  • Integrated Human Practices
  • Expert Interviews
  • Safety & Security
  • Public Engagement
  • Education
  • Collaborations
• Notebook
  • Overview
  • Methods
  • Materials
  • Notebook Database
• Toolbox Guide

RFC

Our In Vivo Evolution Standard

Cloning Standard

The crucial step of to the cloning of PACE circuits is the generation of the accessory plasmid. These plasmids allow geneIII expression dependent on the evolving protein. The link between the fitness of the protein of interest and the expression of geneIII determines the effectiveness of the directed evolution and the presence of ProteinIII is essential for the production of new phage particles. On the one hand, the initial expression of geneIII needs to be strong enough so that phages with the wildtype protein or negligible mutated protein are able to persist in the lagoon, and that they are not washed out. On the other hand, the expression of geneIII should neither be too high, because reproduction of the phage is only linked to it as long proteinIII is the limiting factor. Consequently, regulation of the geneIII expression influences the selection stringency of the directed evolution process.
For these reasons, it is a major challenge of PACE, to provide the right amount of geneIII. The amount of geneIII that is provided, can easily be regulated by changing the RBS and/or the origin of replication. In addition it is in many cases necessary to use more than one AP to vary selection pressure. Therefore, one must find a quick and easy way to modify APs.
If more than one variant of a circuit should be tested at a time, it is necessary to modify the activation region for geneIII and the additional gene that can be located on the AP with a minimum of effort. This is the another reason for a efficient cloning strategy.
To make AP cloning as simple as possible, we defined a new cloning standard that is specifically suited for the assembly of Aps, we wrote a BBF RFC that describes our concept in detail.
We subdivided the accessory plasmid in five subparts with different functionalities: The promoter for transcription of geneIII with associated regulation sequences (1), geneIII itself with an appropriate RBS (2), a fluorescent or luminescent reporter (3), the plasmid backbone (4) and a second expression cassette for additional genes that are needed for the circuit.
Our aim was it to make it possible that these different fragments can easily be assembled and recombined, to minimize the cloning effort. Therefore we created five standard homology regions that seperate the different subparts and enable for fast and efficient Gibson assembly.

Figure X: In our cloning standard, compatible building blocks are defined by specific functionalities. They are flanked by defined homology regions, indicated by numbers, which are necessary for the assembly of the APs with the Gibson method. This results in a highly customizable plasmid, composed of the desired origin of replication, an antibiotic resistance (4-5), a bicistronic operon with geneIII (2-3)and the desired reporter (3-4), which can be activated by any promoter (1-2)and a second expression cassette for additional genes that are necessary for the respective circuit (1-5).

In the following section, our cloning strategy is described in detail.

Homology Regions

We defined five different homology regions (HR) that obey the following criteria: The sequences have a length of 32 bp which is long enough for efficient Gibson assembly. They do not contain the ATG start codon. Furthermore the different sequences have low similarity. Last, they exhibit no secondary structures at 50 °C according to Mfold (http://unafold.rna.albany.edu/?q=mfold). A table with the respective sequences are shown in the table below. Furthermore every homology region starts with an thymine and ends with an adenine. This enables for the compatibility with RFC10 (see below).

Table 1: Standard homology regions for the use for accessory plasmid construction

Homology Region	Sequence
HR1	TACGTTTCGTTACAGAGCTCGCCAGTGGATAA
HR2	TATCAGATCATCGTCGACCTACAGGTGCAGTA
HR3	TGGTCGGTGCCTATCAACTCGAGTAGTACTAA
HR4	TTGTCTGGAGCCAAGCCGCATTTGAAGTACCA
HR5	TCAGTTCTCGTAATGCAGGGCCCAGAATTTCA

1. Promoter and Activation Region The promoter region is flanked by HR1 at the 5'-end and by HR2 at the 3'-end. The promoter is the key part of the PACE circuit. It links the fitness of the evolving protein to the expression of geneIII. Therefore it is important that efficient initiation of transcription is possible by a functional (evolved) protein, whereas nonfunctional proteins exhibit no activity. There are many possibilities to link the activate transcription by a specific protein that can thereby be evolved via PACE. The most obvious example are polymerases, like T7 polymerase that are directly responsible for transcription. Another method is the use of transcription factors that activate gene expression or other DNA binding proteins, which can for example be linked to the RNA polymerase omega subunit (rpoZ), which is able to recruit the transcription machinery. A completely different approach is the activation via riboswitches, which make translation possible after a small molecule has bound. This enable for the evolution of enzymes. For further examples, check out our approaches in the results section.
It is necessary that the activation works robust and even the unevolved protein is able to activate transcription to some extend. At the same time the complete promoter subpart, including both homology regions, should not be shorter than 200 bp to ensure efficient Gibson assembly. 2. GeneIII GeneIII is the main component of the second subpart. As already decribed above, it is crucial to keep the amount of produced proteinIII in a range where it is proportional to phage production. Beside the copy number of the plasmid Its translation is regulated by a specific RBSs. The RBS and the coding sequence of geneIII are flanked by HR2 and HR3. It is important, that there is no terminator downstream of the gen, only a stop codon, because the reporter should be located on the same mRNA in a bicistronic manner. To make cloning as simple as possible, we submitted geneIII in combination with five different RBS'. The used ribosomal binding sites were published by Ringquist et al. 1992 RN140. These RBS span a range of two orders of magnitude and are therefore perfectly suited for tight regulation of geneIII expression.

Table 1: RBS’ used in combination with geneIII in the context of our project; The name of the RBS, the sequence, and the strength relative to SD8 are schown

Name	Sequence	Relative Strength
SD8	AAGGAGGAAAAAAAAA	1.00
SD4	AAGGAGGAAAAA	0.51
sd8	AAAGGAAAAAAAAA	0.20
sd6	AAAAAGGAAAAAAA	0.13
sd2	AAAAAAAAAGGAAA	0.01

3. Reporter Downstream of geneIII a reporter is placed to enable for monitoring of geneIII expression. We cloned a variety of promoters, ranging from fluorescent proteins, like YFP or RFP over liminescent reporters, like luxAB or nLuc to other enzymes like lacZ. Because some proteins are protected by patent, we could send only some of them to the registry. With different reporters, everyone can choose the reporter that suits his experiment setup best. The reporter subpart must be follewed by a stop-codon and a terminator. It needs is own RBS as well. The whole reporter unit should be flanked by HR3 and HR4 for conformity with our cloning standard. 4. Plasmid Backbone The plasmid backbone consists of the origin of replication and an antibiotic resistance. It is bounded by HR4 and HR5. The copy number of the plasmid is the second important factor that regulates the copy number of APs. The more replica of a plasmid exist in a cell, the higher is the expression of the respective genes; geneIII in this case. Consequently, varying the copy number of the AP influences the amount of proteinIII and therefore the selection stringency. We used three different origins of replication in our expreiments: pBR322, which is the standard origin of replication of the registry plasmids and has a copy number of 15-20 copies per cell; p15A, which has only 10 copies per call and pSC101, a low copy origin with only 5 replica (see AddGene). In combination with the different RBS', thiy allows for highly regulated expression of the phage protein. It is important to check the compatibility of the AP origin of replication with all the other plasmids, which need to be used in the experiments.
Regarding the antibiotic resistance, ampicillin is the most probable variant. As large amounts of antibiotics are necessary for PACE, ampicillin is the modt attractive and commonly used alternative for APs. Nonetheless, different experiment setups may require different resistances, which is why we provide different resistance cassettes in the part, we provide on the registry. The backbone must be flanked by HR4 and HR5. 5. Expression of other Proteins The majority of circuits needs more proteins, than geneIII and the evolving protein. As a consequence, our cloning standard provides a space for a second expression cassette in addition to geneIII for other circuit related proteins. There are many cases, in which other proteins may be needed for the PACE experiment. This could be virtually any protein that is needed, for example chaperones for efficient folding of enzymes, proteins that interact with others, gRNA cassettes for CRISPR endonuclease evolution and many more. In this case, it is important to include the full expression cassette between HR1 and HR5, beginning with a promoter, which can be either constitutive or activatable, followed by a RBS and the coding sequence and finally finished by an appropriate terminator. If the termination is not perfect, the second expression cassette should be inserted in the opposite direction than the cassette of geneIII to avoid a secondary expression of geneIII.

Cloning of APs

Our plasmids can easily be assembled via Gibson assembly. In summary, Gibson Aassembly makes use of an exonuclease, which cuts back the 5'-ends of the fragments. Subsequently, the overhangs anneal, gaps are filled up by the phusion polymerase (Thermo Fisher Scientific) and ligated by a taq-ligase. A protocol can be found here.

Assembly of APs from Registry Parts

Many of the parts we tested in our experiments are available from the registry. Among them most of the standard units, which can be used in any in vivo evolution experiment, like geneIII, different backbones and some reporters. Furthermore, we provide parts, which are necessary for the circuits, we designed during iGEM. Obviously, all these sequences are offered as BioBrick parts in pSB1C3. Accordingly, we made our cloning method compatible with RFC10, the BioBrick standard (Fig.: X). All subparts can be cloned into pSB1C3. They only have to be flanked by the respective homology regions and a BglII site, wherat the first or last base of the recognition site is included in the homology region. This is a key criteria, because it facilitates for fast and easy cloning.

Figure X: Compatibility of our cloning stadard with the RFC10;Any AP building block can be cloned into RFC[10] standard by inserting BglII sites between the homology regions and the biobrick prefix or suffix, respectively. To use such a part for AP assembly, it has to be digested with BglII. The resulting fragment should be purified and can subsequently used for Gibson assembly with other parts.

If one wants to use such parts for plasmid assembly, they can be cut with BglII. The appropriate band has to be gelexed and can subsequently used for Gibson assembly. BglII creates 5'-overhangs, which are eliminated by the 5'-exonuclease that is used for Gibson assembly. Only 1 bp, a thymine at the 5'-end or an adenine at the 3'-end, remains. Is this base pair is included in the homology region, it does not interfere with Gibson Assembly. As a result, our standard is fully compatible with RFC10 and our parts from the registry can be included without problems.

}}