Difference between revisions of "Team:CPU CHINA/collaborations"
BaoqiangCPU (Talk | contribs) |
BaoqiangCPU (Talk | contribs) |
||
| Line 28: | Line 28: | ||
<h4><br>According to the figure, we confirmed that the electroporation was successful and thus we were able to continue our experiments. We would like to thank the NJU-CHINA team for the great help for our experiments and for the provision of IL-17RA antibodies.</h4> | <h4><br>According to the figure, we confirmed that the electroporation was successful and thus we were able to continue our experiments. We would like to thank the NJU-CHINA team for the great help for our experiments and for the provision of IL-17RA antibodies.</h4> | ||
<div> | <div> | ||
| − | <img src="https://static.igem.org/mediawiki/2017/3/31/T--CPU_CHINA--collaborations_fig.png" width = "700"> | + | <center><img src="https://static.igem.org/mediawiki/2017/3/31/T--CPU_CHINA--collaborations_fig.png" width = "700"></center> |
</div> | </div> | ||
Revision as of 14:52, 31 October 2017
Collaborations
Collaboration with NJU-CHINA
Our team helped the NJU_CHINA team design two sequence of BCL2-siRNA.
The sequences are as follows:
BCL2-siRNA-3 sequence: GTGGATGACTGAGTACCTGAA
BCL2-siRNA-4 sequence: CTGCATCACTCTGGGTGCATA
The NJU_CHINA team helped us to detect the expression level of Myc-CAR-CD20 and IL-17RA-SynNotch with Western blot. Flag-FOXP3-Jurkat cells expressed the proteins after transfection by electroporation. The result is shown in the figure. They also provided us with human IL-17RA antibodies.
According to the figure, we confirmed that the electroporation was successful and thus we were able to continue our experiments. We would like to thank the NJU-CHINA team for the great help for our experiments and for the provision of IL-17RA antibodies.
