Difference between revisions of "Team:UChile OpenBio-CeBiB/Parts"

Line 58: Line 58:
 
<p><b>a) Seq 2_2 (1890 bp): </b></p>
 
<p><b>a) Seq 2_2 (1890 bp): </b></p>
 
<p>Open reading frame for fusion mCherry-fructose 1,6/sedoheptulose 1,7 bisphosphatase from cyanobacteria Synechococcus sp. (strain WH8103) with a 32-amino acid (96 bp) N-terminal signal peptide for chloroplast destination. This construct replaces the CrGFP site of the vector, and by this way is under the control of the constitutive promoter psaD and have its 3’ UTR TpsaD. A 8 nucleotide linker has been put to allow the right folding of the two proteins.  The code for this sequence is the next: </p>
 
<p>Open reading frame for fusion mCherry-fructose 1,6/sedoheptulose 1,7 bisphosphatase from cyanobacteria Synechococcus sp. (strain WH8103) with a 32-amino acid (96 bp) N-terminal signal peptide for chloroplast destination. This construct replaces the CrGFP site of the vector, and by this way is under the control of the constitutive promoter psaD and have its 3’ UTR TpsaD. A 8 nucleotide linker has been put to allow the right folding of the two proteins.  The code for this sequence is the next: </p>
−
<p>5’-CATATGATGCAGGTGACGATGAAGTCCTCGGCGGTGTCGGGTCAGCGCGTGGGTGGTGCCCGGGTGGCTACCCGCAGCGTGCGCC</p>
+
<p>5’CATATGATGCAGGTGACGATGAAGTCCTCGGCGGTGTCGGGTCAGCGCGTGGGTGGTGCCCGGGTGGCTACCCGCAGCGTGCGCCG</p>
−
<p>GCGCCCAGCTGCAGGTGGTGTCCAAGGGTGAGGAGCTGTTTACGGGCGTGGTGCCGATTCTGGTCGAGCTGGACGGCGACGTGAACGG</p>
+
<p>CGCCCAGCTGCAGGTGGTGTCCAAGGGTGAGGAGCTGTTTACGGGCGTGGTGCCGATTCTGGTCGAGCTGGACGGCGACGTGAACGG</p>
 
<p>TCATAAGTTCTCGGTCAGCGGTGAGGGTGAGGGTGACGCCACCTACGGCAAGCTGACCCTCAAGTTTATTTGCACCACGGGCAAGCT</p>
 
<p>TCATAAGTTCTCGGTCAGCGGTGAGGGTGAGGGTGACGCCACCTACGGCAAGCTGACCCTCAAGTTTATTTGCACCACGGGCAAGCT</p>
 
<p>CCCGGTGCCGTGGCCCACCCTGGTGACCACGCTCACGTACGGTGTCCAGTGCTTTTCCCGCTACCCTGACCACATGAAGCAGCACGA</p>
 
<p>CCCGGTGCCGTGGCCCACCCTGGTGACCACGCTCACGTACGGTGTCCAGTGCTTTTCCCGCTACCCTGACCACATGAAGCAGCACGA</p>
Line 83: Line 83:
 
<p><b>b) Seq 4 (1357 bp): </p></b>
 
<p><b>b) Seq 4 (1357 bp): </p></b>
 
<p>Construct composed by METE promoter, an open reading frame for RFP and 3’ UTR of METE promoter. This construct has the objective to serve like a proof of concept for the production of recombinant protein under the control of this promoter. Also, by this way, we can gather data for the model of our project and make deeper the kinetic characterization of METE promoter. It is a good test for in the future, with the optimized strain of Chlamydomonas reinhardtii try to generate proteins or metabolites that could help to solved the problems of communities like Puchuncavi (data shown in HP section). The sequences is the next one: </p>
 
<p>Construct composed by METE promoter, an open reading frame for RFP and 3’ UTR of METE promoter. This construct has the objective to serve like a proof of concept for the production of recombinant protein under the control of this promoter. Also, by this way, we can gather data for the model of our project and make deeper the kinetic characterization of METE promoter. It is a good test for in the future, with the optimized strain of Chlamydomonas reinhardtii try to generate proteins or metabolites that could help to solved the problems of communities like Puchuncavi (data shown in HP section). The sequences is the next one: </p>
−
<p>
+
−
5’-GCGGCCGCGTAGGTCAGGACCAGAGCCTACAACATTGTAAGGCCATGTATCCTCCAGTGCCATTTGCGACGTTACACGACGAGACAATCTGCGCTGTGTTCAAGCACACACATCCGGGACTCGTGTGATGTCTTAACATCTGCAAGGAAACATAAGGTGGCCGGCGTCACGCAAGATGACGCGACGGACTCGAATGCTTGCTTCGTCCAGCGACAAATAAGGACAGGCAGGGCGCCTGCATTGCGTGCGCTTAGAGGCGAGGCGCTCAAGACATTTCGGCAGCAATAATTGGTATTGAGGCACATTCTGCACCAGGATGCCAAGAGGTGAACGTTGCTGCCTTAATGTATATCTGCACAGCTGGCCGGTTACTGCGAACCGGGTGCCTTTTGGAGTCGCTCCTAAAAGACGTCACCGGCGCAACGTCGTCGTGCGGCCGTACAGGTATGCAAAATTGGCCCGGTTGCGCGCAGGCCGATTATTTAAGTGACATTTGGTACCATGCATGAGCATCCGATTGTTGTTTTGCAATTCTGTCTGACTGCACAAGGAACCCGTCCTTGGGAATCAACATCTGTCAACATGGTGTCCAAGGGGGAGGAGGATAACATGGCGATCATCAAGGAGTTCATGCGGTTTAAGGTCCACATGGAGGGCTCGGTCAACGGGCATGAGTTCGAGATCGAGGGCGAGGGCGAGGGTCGGCCTTACGAGGGCACGCAGACGGCGAAGCTCAAGGTCACCAAGGGGGGCCCTCTCCCTTTTGCGTGGGACATTCTGAGCCCCCAGTTCATGTACGGCTCCAAGGCTTACGTGAAGCATCCGGCTGATATCCCCGATTACCTCAAGCTGAGCTTTCCGGAGGGTTTCAAGTGGGAGCGCGTGATGAACTTCGAGGATGGTGGTGTCGTGACCGTGACCCAGGATAGCTCCCTCCAGGATGGCGAGTTCATTTACAAGGTGAAGCTCCGCGGCACGAACTTCCCCAGCGATGGGCCTGTCATGCAGAAGAAGACGATGGGTTGGGAGGCGTCCAGCGAGCGGATGTACCCCGAGGACGGGGCGCTCAAGGGGGAGATTAAGCAGCGGCTCAAGCTCAAGGACGGCGGGCATTACGACGCTGAGGTCAAGACCACGTACAAGGCCAAGAAGCCTGTGCAGCTCCCCGGTGCTTACAACGTCAACATCAAGCTGGACATCACCAGCCACAACGAGGATTACACCATTGTCGAGCAGTACGAGCGCGCGGAGGGTCGGCATTCCACGGGCGGGATGGATGAGCTGTACAAGTAAAATGCCCGAATGTTGGGTATCTAGCTCACACGGCAGTTTGTAAGGTGCTGAGGCGTTGCTCGAG-3</p>
+
<p>5’GCGGCCGCGTAGGTCAGGACCAGAGCCTACAACATTGTAAGGCCATGTATCCTCCAGTGCCATTTGCGACGTTACACGACGAGACA</p>
 +
<p>ATCTGCGCTGTGTTCAAGCACACACATCCGGGACTCGTGTGATGTCTTAACATCTGCAAGGAAACATAAGGTGGCCGGCGTCACGCAA</p>
 +
<p>GATGACGCGACGGACTCGAATGCTTGCTTCGTCCAGCGACAAATAAGGACAGGCAGGGCGCCTGCATTGCGTGCGCTTAGAGGCGAGG</p>
 +
<p>CGCTCAAGACATTTCGGCAGCAATAATTGGTATTGAGGCACATTCTGCACCAGGATGCCAAGAGGTGAACGTTGCTGCCTTAATGTAT</p>
 +
<p>ATCTGCACAGCTGGCCGGTTACTGCGAACCGGGTGCCTTTTGGAGTCGCTCCTAAAAGACGTCACCGGCGCAACGTCGTCGTGCGGCC</p>
 +
<p>GTACAGGTATGCAAAATTGGCCCGGTTGCGCGCAGGCCGATTATTTAAGTGACATTTGGTACCATGCATGAGCATCCGATTGTTGTTT</p>
 +
<p>TGCAATTCTGTCTGACTGCACAAGGAACCCGTCCTTGGGAATCAACATCTGTCAACATGGTGTCCAAGGGGGAGGAGGATAACATGGC</p>
 +
<p>GATCATCAAGGAGTTCATGCGGTTTAAGGTCCACATGGAGGGCTCGGTCAACGGGCATGAGTTCGAGATCGAGGGCGAGGGCGAGGGT</p>
 +
<p>CGGCCTTACGAGGGCACGCAGACGGCGAAGCTCAAGGTCACCAAGGGGGGCCCTCTCCCTTTTGCGTGGGACATTCTGAGCCCCCAGT</p>
 +
<p>TCATGTACGGCTCCAAGGCTTACGTGAAGCATCCGGCTGATATCCCCGATTACCTCAAGCTGAGCTTTCCGGAGGGTTTCAAGTGGGA</p>
 +
<p>GCGCGTGATGAACTTCGAGGATGGTGGTGTCGTGACCGTGACCCAGGATAGCTCCCTCCAGGATGGCGAGTTCATTTACAAGGTGAAG</p>
 +
<p>CTCCGCGGCACGAACTTCCCCAGCGATGGGCCTGTCATGCAGAAGAAGACGATGGGTTGGGAGGCGTCCAGCGAGCGGATGTACCCCG</p>
 +
<p>AGGACGGGGCGCTCAAGGGGGAGATTAAGCAGCGGCTCAAGCTCAAGGACGGCGGGCATTACGACGCTGAGGTCAAGACCACGTACAA</p>
 +
<p>GGCCAAGAAGCCTGTGCAGCTCCCCGGTGCTTACAACGTCAACATCAAGCTGGACATCACCAGCCACAACGAGGATTACACCATTGTC</p>
 +
<p>GAGCAGTACGAGCGCGCGGAGGGTCGGCATTCCACGGGCGGGATGGATGAGCTGTACAAGTAAAATGCCCGAATGTTGGGTATCTAGC</p>
 +
<p>TCACACGGCAGTTTGTAAGGTGCTGAGGCGTTGCTCGAG-3</p>
 
<p><b>
 
<p><b>
 
c) Seq 1_2: Same sequence of the BBa_K2425000 but without prefix and suffix for Biobricks  
 
c) Seq 1_2: Same sequence of the BBa_K2425000 but without prefix and suffix for Biobricks  

Revision as of 00:21, 1 November 2017

Document

Parts

FBP/SBP-851: BBa_K2425000

Open reading frame for Fructose 1,6/sedoheptulose 1,7 bisphosphatase from cyanobacteria Synechococcus sp. (WH8103 strain ) with a 32-amino acid (96 bp) N-terminal signal peptide for chloroplast destination and codon optimized for expression in Chlamydomonas reinhardtii. This protein is involved in the Calvin cycle, which is part of the carbohydrate biosynthesis pathway. The catalytic activities are:

  • 1) D-fructose 1,6-bisphosphate + H2O = D-fructose 6-phosphate + phosphate //

  • 2) Sedoheptulose 1,7-bisphosphate + H2O = sedoheptulose 7-phosphate + phosphate.

    • This protein has been expressed in chloroplasts of tobacco plant cells using the same chloroplast signal peptide and demonstrated to improve carbon fixation and growth (Miyagawa et al., Nature Biotechnology 19(10):965-9, 2001). Transgenic tobacco plants showed enhanced photosynthetic efficiency and growth characteristics. Compared with wild-type tobacco, final dry matter and photosynthetic CO2 fixation of the transgenic plants were 1.5-fold and 1.24-fold higher, respectively. Levels of intermediates in the Calvin cycle and accumulation of carbohydrates were also higher than those in wild-type plants. The signal peptide corresponds to the 32 amino acid chloroplast transit sequence of the ribulose bisphosphate carboxylase/oxygenase activase preprotein from Chlamydomonas reinhardtii, required for translocation through the envelope of the chloroplast (Krimm et al., Eur. J. Biochem. 265:171-180,1999).

    PONER IMAGEN 1

    This sequence is crucial in the design of Greenhardtii Project, since it has the theoretical function to generate an indirect overexpression of Rubisco activase, who activate RuBisCO and in higher levels (not induced by artificial methods) can produce higher levels in the activity of RuBisCO and through this way, have an optimization of Calvin Cycle (Miyagawa et al., Nature Biotechnology 19(10):965-9, 2001) but the mechanism is not well known. This is the first time that this assay is made and adapted for Chlamydomonas reinhardtii and it has a critical importance for the industrial use of this species.

    Sequence: http://parts.igem.org/Part:BBa_K2425000

    Another Biobrick designed (Not in the iGEM registry):

    We have designed another biobrick for the competence but unfortunately we could not send by the deadline. So we describe here the METEp-850 sequence. This code, correspond to the sequence of the adjustable promoter of the METE gene, which codes for Cobalamin-independent methionine synthase protein. This promoter is regulated by B12 vitamin which has shown the capacity to reduce the transcriptional levels of METE gen (Helliwell et al.,Plant physiology, 165(1), 388-397, 2014). The construct has 574 bp and contain the 5’ UTR and the sequence of the promoter. All the sequences related to METE promoter has been kindly shared by Dra. Alison Smith from the Departament of Plant Sciences of the University of Cambridge. The objective for this sequence is make deeper the characterization of this promoter using our model and at the same time gather data to use this promoter in the production of recombinant protein in the optimized strain of Chlamydomonas reinhardtii. We think that if Chlamydomonas reinhardtii is though like a production platform is very attractive the idea of have the control of its behavior.

    INSERTAR IMAGEN 2

    The sequence for the construct is (including suffix and prefix for biobricks):

    5’GAATTCGCGGCCGCTTCTAGAGGTAGGTCAGGACCAGAGCCTACAACATTGTAAGGCCATGTATCCTCCAGTGCCATTTGCGACG

    TTACACGACGAGACAATCTGCGCTGTGTTCAAGCACACACATCCGGGACTCGTGTGATGTCTTAACATCTGCAAGGAAACATAAGGT

    GGCCGGCGTCACGCAAGATGACGCGACGGACTCGAATGCTTGCTTCGTCCAGCGACAAATAAGGACAGGCAGGGCGCCTGCATT

    GCGTGCGCTTAGAGGCGAGGCGCTCAAGACATTTCGGCAGCAATAATTGGTATTGAGGCACATTCTGCACCAGGATGCCAAGAGG

    TGAACGTTGCTGCCTTAATGTATATCTGCACAGCTGGCCGGTTACTGCGAACCGGGTGCCTTTTGGAGTCGCTCCTAAAAGACGTCA

    CCGGCGCAACGTCGTCGTGCGGCCGTACAGGTATGCAAAATTGGCCCGGTTGCGCGCAGGCCGATTATTTAAGTGACATTTGGTAC

    CATGCATGAGCATCCGATTGTTGTTTTGCAATTCTGTCTGACTGCACAAGGAACCCGTCCTTGGGAATCAACATCTGTCAACTACTAG

    TAGCGGCCGCTGCAG ‘3

    Code: Red = EcoRI, Green=NotI, Brown = XbaI, Pink= PstI, Blue= SpeI, Purple=NdeI.

    Construct designed to use in binary vectors for assays in alga (Not Biobricks):

    For the assays in algae we have decided to use the binary vector pBC1 which is shown in the Figure III. In this vector, we have ligated three diferents constructs. For all the next constructs a codon bias for Chlamydomonas reinhardtii has been made.

    INSERTAR IMAGEN 3

    a) Seq 2_2 (1890 bp):

    Open reading frame for fusion mCherry-fructose 1,6/sedoheptulose 1,7 bisphosphatase from cyanobacteria Synechococcus sp. (strain WH8103) with a 32-amino acid (96 bp) N-terminal signal peptide for chloroplast destination. This construct replaces the CrGFP site of the vector, and by this way is under the control of the constitutive promoter psaD and have its 3’ UTR TpsaD. A 8 nucleotide linker has been put to allow the right folding of the two proteins. The code for this sequence is the next:

    5’CATATGATGCAGGTGACGATGAAGTCCTCGGCGGTGTCGGGTCAGCGCGTGGGTGGTGCCCGGGTGGCTACCCGCAGCGTGCGCCG

    CGCCCAGCTGCAGGTGGTGTCCAAGGGTGAGGAGCTGTTTACGGGCGTGGTGCCGATTCTGGTCGAGCTGGACGGCGACGTGAACGG

    TCATAAGTTCTCGGTCAGCGGTGAGGGTGAGGGTGACGCCACCTACGGCAAGCTGACCCTCAAGTTTATTTGCACCACGGGCAAGCT

    CCCGGTGCCGTGGCCCACCCTGGTGACCACGCTCACGTACGGTGTCCAGTGCTTTTCCCGCTACCCTGACCACATGAAGCAGCACGA

    CTTTTTCAAGTCCGCTATGCCTGAGGGTTACGTGCAGGAGCGGACCATTTTCTTCAAGGACGACGGCAACTACAAGACGCGGGCTGA

    GGTCAAGTTCGAGGGTGATACGCTCGTGAACCGGATCGAGCTGAAGGGTATCGACTTTAAGGAGGATGGTAACATCCTGGGTCACAA

    GCTCGAGTACAACTACAACTCGCATAACGTGTACATTATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATTCGGCA

    CAACATTGAGGACGGTTCCGTCCAGCTGGCCGATCATTACCAGCAGAACACCCCTATTGGTGATGGCCCCGTCCTGCTCCCCGATAA

    CCATTACCTCAGCACGCAGTCGGCCCTGTCGAAGGATCCTAACGAGAAGCGCGACCACATGGTCCTCCTCGAGTTCGTCACCGCGGC

    GGGTATCACCCTCGGCATGGATGAGCTCTACAAGGGTGGTAGCGGCGGCTCGGGGGGCTCCGGGGGCGAGAAGACCATCGGTCTCGA

    GATTATCGAGGTGGTGGAGCAGGCGGCTATTGCCTCGGCCCGCCTCATGGGTAAGGGGGAGAAGAACGAGGCTGATCGGGTCGCCGT

    CGAGGCTATGCGCGTGCGGATGAACCAGGTGGAGATGCTCGGGCGCATCGTCATTGGGGAGGGGGAGCGCGATGAGGCCCCGATGCT

    GTACATTGGGGAGGAGGTGGGGATCTACCGCGACGCGGACAAGCGGGCCGGGGTCCCGGCGGGTAAGCTCGTCGAGATCGACATTGC

    TGTGGACCCCTGCGAGGGGACCAACCTGTGCGCTTACGGCCAGCCTGGTTCCATGGCTGTGCTCGCGATCAGCGAGAAGGGTGGGCT

    GTTCGCCGCTCCTGACTTTTACATGAAGAAGCTCGCGGCGCCGCCGGCTGCCAAGGGCAAGGTCGATATTAACAAGAGCGCGACGGA

    GAACCTCAAGATTCTGAGCGAGTGCCTCGATCGGGCGATTGATGAGCTGGTCGTGGTCGTGATGGATCGCCCGCGGCACAAGGAGCT

    GATCCAGGAGATCCGGCAGGCTGGCGCTCGCGTGCGCCTCATCTCCGACGGTGACGTCTCCGCCGCTATCTCGTGCGGTTTTGCTGG

    CACGAACACGCATGCGCTGATGGGTATTGGTGCTGCGCCGGAGGGGGTGATTTCCGCCGCGGCTATGCGGTGCCTGGGCGGTCATTT

    CCAGGGTCAGCTGATTTACGACCCGGAGGTCGTCAAGACGGGGCTCATCGGGGAGTCGCGCGAGTCCAACATTGCCCGCCTCCAGGA

    GATGGGCATTACGGATCCCGACCGCGTGTACGATGCGAACGAGCTGGCGAGCGGCCAGGAGGTGCTGTTCGCTGCCTGCGGGATCAC

    GCCCGGTCTGCTCATGGAGGGTGTGCGGTTCTTTAAGGGGGGCGCCCGGACGCAGTCCCTCGTGATTAGCTCCCAGAGCCGCACGGC

    TCGCTTTGTGGATACGGTGCACATGTTTGATGACGTCAAGACCGTCTCCCTCCGCTAAGAATTC-3’

    b) Seq 4 (1357 bp):

    Construct composed by METE promoter, an open reading frame for RFP and 3’ UTR of METE promoter. This construct has the objective to serve like a proof of concept for the production of recombinant protein under the control of this promoter. Also, by this way, we can gather data for the model of our project and make deeper the kinetic characterization of METE promoter. It is a good test for in the future, with the optimized strain of Chlamydomonas reinhardtii try to generate proteins or metabolites that could help to solved the problems of communities like Puchuncavi (data shown in HP section). The sequences is the next one:

    5’GCGGCCGCGTAGGTCAGGACCAGAGCCTACAACATTGTAAGGCCATGTATCCTCCAGTGCCATTTGCGACGTTACACGACGAGACA

    ATCTGCGCTGTGTTCAAGCACACACATCCGGGACTCGTGTGATGTCTTAACATCTGCAAGGAAACATAAGGTGGCCGGCGTCACGCAA

    GATGACGCGACGGACTCGAATGCTTGCTTCGTCCAGCGACAAATAAGGACAGGCAGGGCGCCTGCATTGCGTGCGCTTAGAGGCGAGG

    CGCTCAAGACATTTCGGCAGCAATAATTGGTATTGAGGCACATTCTGCACCAGGATGCCAAGAGGTGAACGTTGCTGCCTTAATGTAT

    ATCTGCACAGCTGGCCGGTTACTGCGAACCGGGTGCCTTTTGGAGTCGCTCCTAAAAGACGTCACCGGCGCAACGTCGTCGTGCGGCC

    GTACAGGTATGCAAAATTGGCCCGGTTGCGCGCAGGCCGATTATTTAAGTGACATTTGGTACCATGCATGAGCATCCGATTGTTGTTT

    TGCAATTCTGTCTGACTGCACAAGGAACCCGTCCTTGGGAATCAACATCTGTCAACATGGTGTCCAAGGGGGAGGAGGATAACATGGC

    GATCATCAAGGAGTTCATGCGGTTTAAGGTCCACATGGAGGGCTCGGTCAACGGGCATGAGTTCGAGATCGAGGGCGAGGGCGAGGGT

    CGGCCTTACGAGGGCACGCAGACGGCGAAGCTCAAGGTCACCAAGGGGGGCCCTCTCCCTTTTGCGTGGGACATTCTGAGCCCCCAGT

    TCATGTACGGCTCCAAGGCTTACGTGAAGCATCCGGCTGATATCCCCGATTACCTCAAGCTGAGCTTTCCGGAGGGTTTCAAGTGGGA

    GCGCGTGATGAACTTCGAGGATGGTGGTGTCGTGACCGTGACCCAGGATAGCTCCCTCCAGGATGGCGAGTTCATTTACAAGGTGAAG

    CTCCGCGGCACGAACTTCCCCAGCGATGGGCCTGTCATGCAGAAGAAGACGATGGGTTGGGAGGCGTCCAGCGAGCGGATGTACCCCG

    AGGACGGGGCGCTCAAGGGGGAGATTAAGCAGCGGCTCAAGCTCAAGGACGGCGGGCATTACGACGCTGAGGTCAAGACCACGTACAA

    GGCCAAGAAGCCTGTGCAGCTCCCCGGTGCTTACAACGTCAACATCAAGCTGGACATCACCAGCCACAACGAGGATTACACCATTGTC

    GAGCAGTACGAGCGCGCGGAGGGTCGGCATTCCACGGGCGGGATGGATGAGCTGTACAAGTAAAATGCCCGAATGTTGGGTATCTAGC

    TCACACGGCAGTTTGTAAGGTGCTGAGGCGTTGCTCGAG-3

    c) Seq 1_2: Same sequence of the BBa_K2425000 but without prefix and suffix for Biobricks

    Note

    Note that parts must be documented on the Registry. This page serves to showcase the parts you have made. Future teams and other users and are much more likely to find parts by looking in the Registry than by looking at your team wiki.

    Adding parts to the registry

    You can add parts to the Registry at our Add a Part to the Registry link.

    We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better you will remember all the details about your parts. Remember, you don't need to send us the DNA sample before you create an entry for a part on the Registry. (However, you do need to send us the DNA sample before the Jamboree. If you don't send us a DNA sample of a part, that part will not be eligible for awards and medal criteria.)

    What information do I need to start putting my parts on the Registry?

    The information needed to initially create a part on the Registry is:

    • Part Name
    • Part type
    • Creator
    • Sequence
    • Short Description (60 characters on what the DNA does)
    • Long Description (Longer description of what the DNA does)
    • Design considerations

    We encourage you to put up much more information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page.

    Inspiration

    We have a created a collection of well documented parts that can help you get started.

    You can also take a look at how other teams have documented their parts in their wiki:

    Part Table

    Please include a table of all the parts your team has made during your project on this page. Remember part characterization and measurement data must go on your team part pages on the Registry.