Line 43: | Line 43: | ||
<br> | <br> | ||
<div class="row style1" > | <div class="row style1" > | ||
− | <p>Through <a href="https://2017.igem.org/Team:ECUST/Model">overall modelling</a> of our project, we finally decided to adopted fluorescent protein sYFP2 as our Light-Harvester. By expressing sYFP2 with H subunit (in photosynthesis reaction center of <i>Rhodobacter sphaeroides 2.4.1</i>) as fusion protein, <i>Rhodobacter sphaeroides 2.4.1</I> would have an extra photon absorption at around 514nm. From Figure 1. we discovered that <i>Rhodobacter sphaeroides 2.4.1</i> have absorption peaks at 450-550nm (provided by carotenoids) and 800-900nm (provided by chlorophyll). Since the absorption peaks of carotenoids and sYFP2 may be overlapped to some extent, we need to knock out gene crtB (phytoene synthase), making it unable for <i>Rhodobacter sphaeroides 2.4.1</i> to synthesize carotenoids.</p> | + | <p>Through <a href="https://2017.igem.org/Team:ECUST/Model">overall modelling</a> of our project, we finally decided to adopted fluorescent protein sYFP2 as our Light-Harvester. By expressing sYFP2 with H subunit (in photosynthesis reaction center of <i>Rhodobacter sphaeroides 2.4.1</i>) as fusion protein, <i>Rhodobacter sphaeroides 2.4.1</I> would have an extra photon absorption at around 514nm. From Figure 1. we discovered that <i>Rhodobacter sphaeroides 2.4.1</i> have absorption peaks at 450-550nm (provided by carotenoids) and 800-900nm (provided by chlorophyll). Since the absorption peaks of carotenoids and sYFP2 may be overlapped to some extent, we need to knock out gene <I>crtB</i> (phytoene synthase), making it unable for <i>Rhodobacter sphaeroides 2.4.1</i> to synthesize carotenoids.</p> |
</div> | </div> | ||
<div class="row" align="center"> <img src="https://static.igem.org/mediawiki/2017/5/58/Absorption_spectrum3.png" alt="" style="width: 600px;"> </div> | <div class="row" align="center"> <img src="https://static.igem.org/mediawiki/2017/5/58/Absorption_spectrum3.png" alt="" style="width: 600px;"> </div> | ||
Line 53: | Line 53: | ||
<br><br> | <br><br> | ||
<div class="row style1"> | <div class="row style1"> | ||
− | <p>So we chose <i>Rhodobacter sphaeroides 2.4.1</i> as our chassis, and after codon optimization of sYFP2, we constructed a plasmid for knocking out crtB based on pDM4 and another plasmid for fusing sYFP2 and H-subunit (the relative code gene of H-subunit is puhA). After that, we constructed an inducible expression pIND4 and another plasmid for cytoplasmic expression of sYFP2 based on that. Then we got three kinds of recombinant strains we need by conjugation or electro-transformation.Finally, we would carry out some subsequent determination including absorption spectrum, growth curve and hydrogen production.</p> | + | <p>So we chose <i>Rhodobacter sphaeroides 2.4.1</i> as our chassis, and after codon optimization of sYFP2, we constructed a plasmid for knocking out <I>crtB</i> based on pDM4 and another plasmid for fusing sYFP2 and H-subunit (the relative code gene of H-subunit is puhA). After that, we constructed an inducible expression pIND4 and another plasmid for cytoplasmic expression of sYFP2 based on that. Then we got three kinds of recombinant strains we need by conjugation or electro-transformation.Finally, we would carry out some subsequent determination including absorption spectrum, growth curve and hydrogen production.</p> |
</div> | </div> | ||
<div class="row" align="center"> <img src="https://static.igem.org/mediawiki/2017/7/72/111.png" alt="" style="width: 800px;"> </div> | <div class="row" align="center"> <img src="https://static.igem.org/mediawiki/2017/7/72/111.png" alt="" style="width: 800px;"> </div> | ||
Line 99: | Line 99: | ||
− | <div class="panel-group" id="accordion" role="tablist" aria- | + | <div class="panel-group" id="accordion" role="tablist" aria-mμLtiselectable="true"> |
− | <div class="panel panel- | + | <div class="panel panel-defaμLt" > |
<div class="panel-heading"> | <div class="panel-heading"> | ||
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
Line 195: | Line 195: | ||
<div class="row" align="center"> <img src="https://static.igem.org/mediawiki/2017/3/33/Ep_cycle.png" alt="" style="width: 600px;"> </div> | <div class="row" align="center"> <img src="https://static.igem.org/mediawiki/2017/3/33/Ep_cycle.png" alt="" style="width: 600px;"> </div> | ||
− | <p><b>PCR | + | <p><b>PCR System(50μL):</b></p> |
<div class="bs-docs-section"> | <div class="bs-docs-section"> | ||
<div class="row"> | <div class="row"> | ||
Line 204: | Line 204: | ||
<tr> | <tr> | ||
<td>5xl Gxl Buffer</td> | <td>5xl Gxl Buffer</td> | ||
− | <td>10 | + | <td>10 μL</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>dNTP</td> | <td>dNTP</td> | ||
− | <td>4 | + | <td>4 μL</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>Gxl polymerase</td> | <td>Gxl polymerase</td> | ||
− | <td>1 | + | <td>1 μL</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>Forward primer</td> | <td>Forward primer</td> | ||
− | <td>2 | + | <td>2 μL</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>Reverse primer</td> | <td>Reverse primer</td> | ||
− | <td>2 | + | <td>2 μL</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
<td>template</td> | <td>template</td> | ||
− | <td>1 | + | <td>1 μL</td> |
</tr> | </tr> | ||
Line 245: | Line 245: | ||
<div class="panel-group" id="accordion"> | <div class="panel-group" id="accordion"> | ||
− | <div class="panel panel- | + | <div class="panel panel-defaμLt"> |
<div class="panel-heading"> | <div class="panel-heading"> | ||
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
Line 260: | Line 260: | ||
<div style="margin-left:10px;"></div> | <div style="margin-left:10px;"></div> | ||
<p> | <p> | ||
− | PCR fragment (concentration requirement> 100 ng / | + | PCR fragment (concentration requirement> 100 ng / μL)<br> |
− | Linearized plasmids (concentration requirements> 100 ng / | + | Linearized plasmids (concentration requirements> 100 ng / μL, can be prepared by digestion or reverse PCR)<br> |
1.33x ITA reagent<br></p> | 1.33x ITA reagent<br></p> | ||
Line 281: | Line 281: | ||
<div class="panel-group" id="accordion"> | <div class="panel-group" id="accordion"> | ||
− | <div class="panel panel- | + | <div class="panel panel-defaμLt"> |
<div class="panel-heading"> | <div class="panel-heading"> | ||
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
Line 330: | Line 330: | ||
<div style="margin-left:10px;"></div> | <div style="margin-left:10px;"></div> | ||
<ol style="font-size:16px;"> | <ol style="font-size:16px;"> | ||
− | <li>Select monoclonal strains to LB plate with chl resistance, and carry out PCR after | + | <li>Select monoclonal strains to LB plate with chl resistance, and carry out PCR after cμLture for 2h</li> |
<li>PCR</li> | <li>PCR</li> | ||
<div id="myTabContent" class="tab-content"> | <div id="myTabContent" class="tab-content"> | ||
<div class="tab-pane fade" id="Method"> | <div class="tab-pane fade" id="Method"> | ||
− | <p>PCR | + | <p>PCR system(10μL):</p> |
<table class="table table-striped table-bordered table-hover" > | <table class="table table-striped table-bordered table-hover" > | ||
<tbody> | <tbody> | ||
Line 344: | Line 344: | ||
<tr class="warning"> | <tr class="warning"> | ||
<td>dNTP</td> | <td>dNTP</td> | ||
− | <td>0. | + | <td>0.8μL</td> |
</tr> | </tr> | ||
<tr class="warning"> | <tr class="warning"> | ||
Line 373: | Line 373: | ||
</div> | </div> | ||
− | <li>Examine the | + | <li>Examine the resμLts using electrophoresis. If positive, inocμLate 5 mL to LB plat with chl resistance for overnight cμLture. Preserve the stains with 15% glycerol.</li> |
</ol> | </ol> | ||
Line 389: | Line 389: | ||
<h4>1.2 Conjugation</h4><br> | <h4>1.2 Conjugation</h4><br> | ||
<div class="row style1" > | <div class="row style1" > | ||
− | <p>In order to achieve gene knockout / knocking, we use a special pDM4 plasmid, the plasmid has a mob element, which can be used to facilitate the use of bonding method of transformation, in addition to pDM4 on the replicator oriV, so within the | + | <p>In order to achieve gene knockout / knocking, we use a special pDM4 plasmid, the plasmid has a mob element, which can be used to facilitate the use of bonding method of transformation, in addition to pDM4 on the replicator oriV, so within the globμLar bacteria can not be copied (Erythrocytes abscess λπ factor), can be re-recombined by chl resistance on the plasmid. Finally, through the SacB gene on pDM4, sucrose was screened for secondary recombination.</p> |
</div> | </div> | ||
<h5>1.2.1 Main Protocols:</h5> | <h5>1.2.1 Main Protocols:</h5> | ||
<div class="panel-group" id="accordion"> | <div class="panel-group" id="accordion"> | ||
− | <div class="panel panel- | + | <div class="panel panel-defaμLt"> |
<div class="panel-heading"> | <div class="panel-heading"> | ||
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
Line 418: | Line 418: | ||
<ol style="font-size:16px;"> | <ol style="font-size:16px;"> | ||
<li>Ecoli-sm10, <i>Rhodobacter sphaeroides 2.4.1</i> were incubated overnight for 12 h. Add the corresponding antibiotics to donor bacteria .</li> | <li>Ecoli-sm10, <i>Rhodobacter sphaeroides 2.4.1</i> were incubated overnight for 12 h. Add the corresponding antibiotics to donor bacteria .</li> | ||
− | <li> Ecoli-sm10, <i>Rhodobacter sphaeroides 2.4.1</i> secondary | + | <li> Ecoli-sm10, <i>Rhodobacter sphaeroides 2.4.1</i> secondary cμLture, add the appropriate antibiotic into the donor bacteria medium, shake to the logarithmic growth phase.</li> |
− | <li> Take Ecoli-sm10, <i>Rhodobacter sphaeroides 2.4.1</i>, each | + | <li> Take Ecoli-sm10, <i>Rhodobacter sphaeroides 2.4.1</i>, each 1 mL wash with PBS and mix them, take 25 μL drop in the dried adhesive film, dry. CμLtivate overnight.</li> |
− | <li> Wash the bacteria moss on the joint membrane with 1 | + | <li> Wash the bacteria moss on the joint membrane with 1 mL of medium or PBS and take 100 μL of the coated plate. The resμLts were observed after several hours of cμLture.</li> |
<li>After one screening, it was induced with TSB containing 10% sucrose and then subjected to secondary screening on a plate containing 10% sucrose free of resistance.</li> | <li>After one screening, it was induced with TSB containing 10% sucrose and then subjected to secondary screening on a plate containing 10% sucrose free of resistance.</li> | ||
<li>Validate gene knockout and gene knocking by priming pairs on the genome.</li> | <li>Validate gene knockout and gene knocking by priming pairs on the genome.</li> | ||
Line 461: | Line 461: | ||
<h5>2.1.1 Main Protocols:</h5><br> | <h5>2.1.1 Main Protocols:</h5><br> | ||
− | <div class="panel-group" id="accordion" role="tablist" aria- | + | <div class="panel-group" id="accordion" role="tablist" aria-mμLtiselectable="true"> |
− | <div class="panel panel- | + | <div class="panel panel-defaμLt" > |
<div class="panel-heading"> | <div class="panel-heading"> | ||
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
Line 539: | Line 539: | ||
− | <div class="panel-group" id="accordion" role="tablist" aria- | + | <div class="panel-group" id="accordion" role="tablist" aria-mμLtiselectable="true"> |
− | <div class="panel panel- | + | <div class="panel panel-defaμLt" > |
<div class="panel-heading"> | <div class="panel-heading"> | ||
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
Line 634: | Line 634: | ||
<h5>2.2.2 Main protocols:</h5> | <h5>2.2.2 Main protocols:</h5> | ||
− | <div class="panel-group" id="accordion" role="tablist" aria- | + | <div class="panel-group" id="accordion" role="tablist" aria-mμLtiselectable="true"> |
− | <div class="panel panel- | + | <div class="panel panel-defaμLt" > |
<div class="panel-heading"> | <div class="panel-heading"> | ||
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
<a role="button" data-toggle="collapse" data-parent="#accordion" href="#collapse7" aria-expanded="false" aria-controls="collapse7"> | <a role="button" data-toggle="collapse" data-parent="#accordion" href="#collapse7" aria-expanded="false" aria-controls="collapse7"> | ||
<div> | <div> | ||
− | <div class="col-md-11">PCR | + | <div class="col-md-11">PCR from plasmids</div> |
<div class="col-md-1"><i class="fa fa-arrow-down fa-10" aria-hidden="true"></i></div> | <div class="col-md-1"><i class="fa fa-arrow-down fa-10" aria-hidden="true"></i></div> | ||
</div> | </div> | ||
Line 660: | Line 660: | ||
<div style="margin-left:10px;"></div> | <div style="margin-left:10px;"></div> | ||
<ol style="font-size:16px;"> | <ol style="font-size:16px;"> | ||
− | <li>Configuration of double enzyme digestion | + | <li>Configuration of double enzyme digestion system:</li> |
− | + | <p><b>Digestion System(50μL):</b></p> | |
− | + | <div class="bs-docs-section"> | |
− | + | <div class="row"> | |
− | + | <div class="col-md-12"> | |
− | + | <div class="bs-example table-responsive"> | |
− | + | <table class="table table-striped table-bordered table-hover" > | |
− | + | <tbody> | |
− | + | <tr> | |
+ | <td>NcoI</td> | ||
+ | <td>1 μL</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>BamHI</td> | ||
+ | <td>1 μL</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>10 x Buffer </td> | ||
+ | <td>5 μL (NEB's buffer score 1.1 2.1 3.1 star specific see enzyme instructions select the cutting efficiency and asterisk the best activity)</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>ddH<sub>2</sub>O</td> | ||
+ | <td>added as appropriate</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>DNA</td> | ||
+ | <td>1 μg</td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
<li>the reaction temperature of 37 ℃ 15min (specific reaction time see the instructions).</li> | <li>the reaction temperature of 37 ℃ 15min (specific reaction time see the instructions).</li> | ||
<li>After the end of the reaction 80 ℃ 20min inactivation.</li> | <li>After the end of the reaction 80 ℃ 20min inactivation.</li> | ||
Line 681: | Line 707: | ||
− | <div class="panel-group" id="accordion" role="tablist" aria- | + | <div class="panel-group" id="accordion" role="tablist" aria-mμLtiselectable="true"> |
− | <div class="panel panel- | + | <div class="panel panel-defaμLt" > |
<div class="panel-heading"> | <div class="panel-heading"> | ||
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
Line 707: | Line 733: | ||
<div style="margin-left:10px;"></div> | <div style="margin-left:10px;"></div> | ||
<ol style="font-size:16px;"> | <ol style="font-size:16px;"> | ||
− | <li>According to the external source and carrier concentration ratio of 5: 1 configuration connection system | + | <li>According to the external source and carrier concentration ratio of 5: 1 configuration connection system 20μL</li> |
− | + | <p><b>Ligation System(20μL):</b></p> | |
− | + | <div class="bs-docs-section"> | |
− | + | <div class="row"> | |
− | + | <div class="col-md-12"> | |
− | + | <div class="bs-example table-responsive"> | |
− | + | <table class="table table-striped table-bordered table-hover" > | |
− | + | <tbody> | |
− | + | <tr> | |
+ | <td>10 x buffer</td> | ||
+ | <td>2 μL</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>T4 DNA ligase</td> | ||
+ | <td>1 μL</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>plasmid DNA</td> | ||
+ | <td>X μL</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td>PCR DNA</td> | ||
+ | <td>Y μL</td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> <p> | ||
<li>16 ℃for 1 h</li> | <li>16 ℃for 1 h</li> | ||
− | <li>The connection solution to take | + | <li>The connection solution to take 10μL to transform, with kanr resistance screening positive bacteria</li> |
</ol> | </ol> | ||
Line 728: | Line 775: | ||
− | <div class="panel-group" id="accordion" role="tablist" aria- | + | <div class="panel-group" id="accordion" role="tablist" aria-mμLtiselectable="true"> |
− | <div class="panel panel- | + | <div class="panel panel-defaμLt" > |
<div class="panel-heading"> | <div class="panel-heading"> | ||
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
Line 753: | Line 800: | ||
<div style="margin-left:10px;"></div> | <div style="margin-left:10px;"></div> | ||
<ol style="font-size:16px;"> | <ol style="font-size:16px;"> | ||
− | <li>32℃ overnight | + | <li>32℃ overnight cμLture and transfer, until the OD grows to about 2.5</li> |
− | <li>10 | + | <li>10 mL of bacteria at 5000 rpm for 5 min to collect all the cells</li> |
− | <li> | + | <li>2 mL sterile water pumped retrogradesum (washed away from the medium ion residue, centrifuged at 5000 rpm for 2 min)</li> |
− | <li>with | + | <li>with 200μL 10% glycerol resuspend the bacteria</li> |
− | <li> | + | <li>100μL of competent and 100ng plasmid mixed</li> |
<li>by adding 2mm electric rotor 1.5Kv shock (voltage index curve mode, capacitance 25uF, resistance 200Ω)</li> | <li>by adding 2mm electric rotor 1.5Kv shock (voltage index curve mode, capacitance 25uF, resistance 200Ω)</li> | ||
− | <li>600 | + | <li>600 μLTSB mixed and moved into the EP tube</li> |
<li>32℃, 220rpm recovery 2h</li> | <li>32℃, 220rpm recovery 2h</li> | ||
− | <li>5000 rpm after centrifugation, remove the | + | <li>5000 rpm after centrifugation, remove the 400μL supernatant, the remaining bacteria coated on kanr resistant plate</li> |
− | <li> | + | <li>cμLture 2-3d observation resμLts</li> |
</ol> | </ol> | ||
Line 786: | Line 833: | ||
− | <div class="panel-group" id="accordion" role="tablist" aria- | + | <div class="panel-group" id="accordion" role="tablist" aria-mμLtiselectable="true"> |
− | <div class="panel panel- | + | <div class="panel panel-defaμLt" > |
<div class="panel-heading"> | <div class="panel-heading"> | ||
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
Line 812: | Line 859: | ||
− | <div class="panel-group" id="accordion" role="tablist" aria- | + | <div class="panel-group" id="accordion" role="tablist" aria-mμLtiselectable="true"> |
− | <div class="panel panel- | + | <div class="panel panel-defaμLt" > |
<div class="panel-heading"> | <div class="panel-heading"> | ||
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
Line 826: | Line 873: | ||
<div class="panel-body"> | <div class="panel-body"> | ||
<div class="row style1"> | <div class="row style1"> | ||
− | <p>Cells were | + | <p>Cells were cμLtured in TSB medium. After overnight incubation, the OD<sub>700</sub> was 0.02 and then the photosynthetic growth curve of 0-24 h was recorded. The cells were given sufficient oxygen. The light source was white LED lamp or green LED lamp (main wavelength For 520nm), the illuminance parameters measured by the illuminometer are shown below</p> |
</div> | </div> | ||
<div class="row" align="center"> <img src="https://static.igem.org/mediawiki/2017/8/86/Ep_8.png" alt="" style="width: 600px;"> </div> | <div class="row" align="center"> <img src="https://static.igem.org/mediawiki/2017/8/86/Ep_8.png" alt="" style="width: 600px;"> </div> | ||
<center> | <center> | ||
<div style="font-size:10px;"> | <div style="font-size:10px;"> | ||
− | <p >Figure 8:The illuminance of LED | + | <p >Figure 8:The illuminance of LED bμLb used in experiment</p></div> |
</center> | </center> | ||
</div> | </div> | ||
Line 841: | Line 888: | ||
− | <div class="panel-group" id="accordion" role="tablist" aria- | + | <div class="panel-group" id="accordion" role="tablist" aria-mμLtiselectable="true"> |
− | <div class="panel panel- | + | <div class="panel panel-defaμLt" > |
<div class="panel-heading"> | <div class="panel-heading"> | ||
<h4 class="panel-title"> | <h4 class="panel-title"> | ||
Line 867: | Line 914: | ||
K2HPO4 ·2H20 1.572g<br> | K2HPO4 ·2H20 1.572g<br> | ||
Yeast extract fermentation 1.0g<br> | Yeast extract fermentation 1.0g<br> | ||
− | Solution of trace element 1. | + | Solution of trace element 1.0 mL<br> |
− | Solution of growth factor 1. | + | Solution of growth factor 1.0 mL<br> |
− | For | + | For 100 mL solution of trace element:<br> |
0.21 g MnSO4 · 4H2O<br> | 0.21 g MnSO4 · 4H2O<br> | ||
0.28 g H3BO3<br> | 0.28 g H3BO3<br> | ||
Line 875: | Line 922: | ||
0.024 g ZnSO4 · 7H2O,<br> | 0.024 g ZnSO4 · 7H2O,<br> | ||
0.075 g Na2MoO4 · 2H2O<br><br><br> | 0.075 g Na2MoO4 · 2H2O<br><br><br> | ||
− | <b>For | + | <b>For 100 mL solution of growth factor:</b><br> |
0.01g biotin<br> | 0.01g biotin<br> | ||
0.5g thiamine HCl<br> | 0.5g thiamine HCl<br> | ||
Line 884: | Line 931: | ||
<div style="margin-left:10px;"></div> | <div style="margin-left:10px;"></div> | ||
<ol style="font-size:16px;"> | <ol style="font-size:16px;"> | ||
− | <li><i>Rhodobacter sphaeroides 2.4.1</i> were | + | <li><i>Rhodobacter sphaeroides 2.4.1</i> were cμLtured in TSB medium for 48h</li> |
− | <li>Took | + | <li>Took 10 mL bacterial suspension and removed the clear supernatant extract after demission at 3500rpm for 5 minutes</li> |
− | <li>Resuspended the bacteria in | + | <li>Resuspended the bacteria in 10 mL fermentation medium and transferred them into a new conical flask</li> |
− | <li>Added | + | <li>Added 90 mL fermentation medium into the flask with 100μL solution of growth factor, 100μL solution of trace element, 30ng/μL kanamycin and 100μL IPTG (making the final concentration 800μL) </li> |
<li>Introduced argon to the flask through rubber tube for 5 min and wrapped the bottleneck with plastic membrane in case of gaseous escape</li> | <li>Introduced argon to the flask through rubber tube for 5 min and wrapped the bottleneck with plastic membrane in case of gaseous escape</li> | ||
<li>Pressed the bottleneck with rubber stopper and sealed it with parafilm</li> | <li>Pressed the bottleneck with rubber stopper and sealed it with parafilm</li> | ||
− | <li> | + | <li>CμLtured the bacteria in the flask which was exposed to 4,000lx under anaerobic condition with nutrient at 32℃ </li> |
− | <li>Collected the gas based on water gas displacing principle using pinhead through rubber stopper and the pinhead | + | <li>Collected the gas based on water gas displacing principle using pinhead through rubber stopper and the pinhead shoμLd be covered with Vaseline</li> |
− | <li>Drew bacterial suspension with syringe and measured OD every 24 hours. After each measurement, the pinhead | + | <li>Drew bacterial suspension with syringe and measured OD every 24 hours. After each measurement, the pinhead shoμLd be covered with Vaseline.</li> |
</ol> | </ol> | ||
Revision as of 21:28, 1 November 2017
![](https://static.igem.org/mediawiki/2017/5/50/BackTop.png)
![](https://static.igem.org/mediawiki/2017/7/7d/EXPERIMENT.png )
Review
Through overall modelling of our project, we finally decided to adopted fluorescent protein sYFP2 as our Light-Harvester. By expressing sYFP2 with H subunit (in photosynthesis reaction center of Rhodobacter sphaeroides 2.4.1) as fusion protein, Rhodobacter sphaeroides 2.4.1 would have an extra photon absorption at around 514nm. From Figure 1. we discovered that Rhodobacter sphaeroides 2.4.1 have absorption peaks at 450-550nm (provided by carotenoids) and 800-900nm (provided by chlorophyll). Since the absorption peaks of carotenoids and sYFP2 may be overlapped to some extent, we need to knock out gene crtB (phytoene synthase), making it unable for Rhodobacter sphaeroides 2.4.1 to synthesize carotenoids.
![](https://static.igem.org/mediawiki/2017/5/58/Absorption_spectrum3.png)
Figure 1:Room temperature absorption spectra of membranes from wild type normalised to 590 nm
So we chose Rhodobacter sphaeroides 2.4.1 as our chassis, and after codon optimization of sYFP2, we constructed a plasmid for knocking out crtB based on pDM4 and another plasmid for fusing sYFP2 and H-subunit (the relative code gene of H-subunit is puhA). After that, we constructed an inducible expression pIND4 and another plasmid for cytoplasmic expression of sYFP2 based on that. Then we got three kinds of recombinant strains we need by conjugation or electro-transformation.Finally, we would carry out some subsequent determination including absorption spectrum, growth curve and hydrogen production.
![](https://static.igem.org/mediawiki/2017/7/72/111.png)
Figure 2:Work flow of our project about experiment in wetlab
Finally, we will characterize our engineering bacteria, including absorption spectra, photosynthetic growth curves and hydrogen production experiments.
1. Knock in (sYFP2)/ Knock out(crtB)
![](https://static.igem.org/mediawiki/2017/0/0a/Ep_3.png)
Figure 3:Work flow of Knock in/out experiment
1.1 Gibson assembly
Since the gene fragments related to gene knock-out and knock-in involves assembly of three fragments, we adopted Gibson Assembly to assemble upstream fragment, downstream fragment and sYFP2 onto the plasmid.
![](https://static.igem.org/mediawiki/2017/7/7d/Ko1.png)
![](https://static.igem.org/mediawiki/2017/5/52/Ki1.png)
Figure 4:Two devices used in Knock in and Knock out experiment.
1.1.1 Main Protocols
Materials:
5xl Gxl Buffer
Primer star Gxl(DNA polymerase)
dNTP
ddH2O
Rhodobacter sphaeroides 2.4.1 genome
plasmid backbone with sYFP2 gene
Forward/Reverse Primer:
crtBUF1 | GAGCTCAGGTTACCCGCATGCAAGATCTATACACGTTCTATGCGCTCTCG |
crtBUR1 | AGGCCGACTGCAAGATCC |
crtBUF2 | GGATCTTGCAGTCGGCCT |
crtBUR2 | TGAGAACCTACATTCCGCGGCAAGCCTTT |
crtBDF | CCGCGGAATGTAGGTTCTCATGAAGGTATACCGG |
crtBDR | CCCTCGAGTACGCGTCACTAGTGGGGCCCTGATCAGGTAGGGCACGAACA |
puhAYFPUF | GAGCTCAGGTTACCCGCATGCAAGATCTATACGGCCACAACAAGATCAAGC |
puhAYFPUR | TGCTCACCATGGCGTATTCGGCCAGCATCG |
YFPF | CGAATACGCCATGGTGAGCAAGGGCGA |
YFPR | CATGCGGGGATCATTACTTGTACAGCTCGTC |
puhAYFPDF | CAAGTAATGATCCCCGCATGGCGCGGCCC |
puhAYFPDR | CCCTCGAGTACGCGTCACTAGTGGGGCCCTCATCCGCAGGGCGATGGTA |
Method:
PCR program:
![](https://static.igem.org/mediawiki/2017/3/33/Ep_cycle.png)
PCR System(50μL):
5xl Gxl Buffer | 10 μL |
dNTP | 4 μL |
Gxl polymerase | 1 μL |
Forward primer | 2 μL |
Reverse primer | 2 μL |
template | 1 μL |
Materials:
PCR fragment (concentration requirement> 100 ng / μL)
Linearized plasmids (concentration requirements> 100 ng / μL, can be prepared by digestion or reverse PCR)
1.33x ITA reagent
Method:
- Add all kinds of PCR fragments and linear plasmids of the same mass to 1.33x ITA reagents (7.5 µL), making total volume 10 µL
- Keep the system at 50°C for 1h
- Transform 10 µL ligation liquid and select using chl resistance
Materials:
10xl Taq Buffer
Taq polymerase
dNTP
ddH2O
Forward/Reverse Primer:
pDM4-F | aacaagccagggatgtaacgc |
pDM4-R | tccagtggcttctgtttcta |
Method:
- Select monoclonal strains to LB plate with chl resistance, and carry out PCR after cμLture for 2h
- PCR
- Examine the resμLts using electrophoresis. If positive, inocμLate 5 mL to LB plat with chl resistance for overnight cμLture. Preserve the stains with 15% glycerol.
PCR system(10μL):
5xl Taq Buffer | 2 µL |
dNTP | 0.8μL |
Taq polymerase | 0.2 µL |
Forward primer | 0.5 µL |
Reverse primer | 0.5 µL |
template | 1 µL |
ddH2O | 5 µL |
PCR procedure
![](https://static.igem.org/mediawiki/2017/3/33/Ep_cycle.png)
1.2 Conjugation
In order to achieve gene knockout / knocking, we use a special pDM4 plasmid, the plasmid has a mob element, which can be used to facilitate the use of bonding method of transformation, in addition to pDM4 on the replicator oriV, so within the globμLar bacteria can not be copied (Erythrocytes abscess λπ factor), can be re-recombined by chl resistance on the plasmid. Finally, through the SacB gene on pDM4, sucrose was screened for secondary recombination.
1.2.1 Main Protocols:
Materials:
Rhodobacter sphaeroides 2.4.1
Ecoli-sm10
Joint film
LB medium
PBS buffer
Method:
- Ecoli-sm10, Rhodobacter sphaeroides 2.4.1 were incubated overnight for 12 h. Add the corresponding antibiotics to donor bacteria .
- Ecoli-sm10, Rhodobacter sphaeroides 2.4.1 secondary cμLture, add the appropriate antibiotic into the donor bacteria medium, shake to the logarithmic growth phase.
- Take Ecoli-sm10, Rhodobacter sphaeroides 2.4.1, each 1 mL wash with PBS and mix them, take 25 μL drop in the dried adhesive film, dry. CμLtivate overnight.
- Wash the bacteria moss on the joint membrane with 1 mL of medium or PBS and take 100 μL of the coated plate. The resμLts were observed after several hours of cμLture.
- After one screening, it was induced with TSB containing 10% sucrose and then subjected to secondary screening on a plate containing 10% sucrose free of resistance.
- Validate gene knockout and gene knocking by priming pairs on the genome.
2. Expression of sYFP2 in cytoplasm
![](https://static.igem.org/mediawiki/2017/0/02/Ep_5.png)
Figure 5:Work flow of expression experiment.
As an experimental control group, and whether the optimized post-sYFP2 can be expressed in the cytoplasmic case (as a prerequisite for fusion expression), we hope to be able to express sYFP2 stably in the cytoplasm of Rhodobacter sphaeroides 2.4.1.
2.1 Reconstruction of PIND4
Prof. Gaoyi Tan provided us with a copy plasmid pIND4 in Rhodobacter sphaeroides 2.4.1, but it was a constant expression (without induction). To make the expression controllable, we inserted the repressor protein LacIq and its corresponding operon into the plasmid by reconstructing the plasmid , transfer it into a lactose operon-inducible plasmid.
![](https://static.igem.org/mediawiki/parts/8/89/LacIq.png)
Figure 6:The devices used in improvement of pIND4
2.1.1 Main Protocols:
Materials:
5xl Gxl Buffer
Primer star Gxl(DNA polymerase)
dNTP
ddH2O
pIND4 plasmid
pMCS-eq plasmid
Forward/Reverse Primer:
F1 | CTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCT |
R1 | CGAGCTCGAATTCGCGCGGCCCTGCATTAA |
F2 | GCCGCGCGAATTCGAGCTCGGTACCGACGT |
R2 | GGTGGTGAATGTGAAACCAGTAACGTTATACGAT |
F3 | CTGGTTTCACATTCACCACCCTGAATTGACTCT |
R3 | AGATCTGGATCCTCCCATGGTTAATTTCTCCTCTTTAATT |
Method:
Mentioned above.
Mentioned above.
2.2 Clone optimization with unoptimized sYFP2
2.2.1 Use the jcat site for codon optimization
sYFP2(Part:BBa_K864100) | sYFP2(Part:BBa_K2308003) |
---|---|
ATGGTTAGCAAGGGCGAAGAACTTTTTACAGGCGTAGTACCGATCTTA GTTGAATTAGACGGCGACGTTAACGGTCATAAGTTTAGCGTGAGCGGTGAG GGTGAAGGTGACGCAACTTACGGCAAGCTGACCCTGAAGCTGATTTGCACG ACGGGTAAGCTGCCGGTCCCGTGGCCTACCCTGGTCACGACCTTGGGTTAT GGCGTTCAGTGTTTCGCGCGTTATCCGGACCACATGAAACAACACGATTTCT TTAAGAGCGCGATGCCAGAAGGCTATGTGCAGGAGCGTACGATCTTTTTCAA AGACGACGGTAACTACAAGACGCGTGCCGAAGTCAAATTCGAAGGCGACAC CCTGGTGAATCGCATTGAGCTGAAGGGTATTGATTTCAAAGAGGATGGCAAT ATCCTGGGTCACAAGCTGGAGTACAATTACAATTCCCACAACGTTTACATCA CCGCAGATAAACAGAAAAATGGCATCAAAGCGAATTTCAAAATCCGTCACAA CATTGAGGACGGTGGTGTTCAACTGGCGGATCATTACCAGCAAAACACCCC GATTGGTGACGGTCCGGTCCTGTTGCCGGATAACCATTATCTGTCTTACCAA AGCAAACTGAGCAAAGATCCGAACGAGAAGCGCGACCACATGGTGCTGCTG GAGTTTGTGACCGCTGCCGGTATTACCCTGGGTATGGATGAGCTGTATAAATGA | ATGGTTAGCAAGGGCGAAGAACTTTTTACAGGCGTAGTACCGATCTTAG TTGAATTAGACGGCGACGTTAACGGTCATAAGTTTAGCGTGAGCGGTGAGG GTGAAGGTGACGCAACTTACGGCAAGCTGACCCTGAAGCTGATTTGCACGA CGGGTAAGCTGCCGGTCCCGTGGCCTACCCTGGTCACGACCTTGGGTTAT GGCGTTCAGTGTTTCGCGCGTTATCCGGACCACATGAAACAACACGATTTC TTTAAGAGCGCGATGCCAGAAGGCTATGTGCAGGAGCGTACGATCTTTTTC AAAGACGACGGTAACTACAAGACGCGTGCCGAAGTCAAATTCGAAGGCGA CACCCTGGTGAATCGCATTGAGCTGAAGGGTATTGATTTCAAAGAGGATGG CAATATCCTGGGTCACAAGCTGGAGTACAATTACAATTCCCACAACGTTTAC ATCACCGCAGATAAACAGAAAAATGGCATCAAAGCGAATTTCAAAATCCGTC ACAACATTGAGGACGGTGGTGTTCAACTGGCGGATCATTACCAGCAAAACA CCCCGATTGGTGACGGTCCGGTCCTGTTGCCGGATAACCATTATCTGTCTT ACCAAAGCAAACTGAGCAAAGATCCGAACGAGAAGCGCGACCACATGGTG CTGCTGGAGTTTGTGACCGCTGCCGGTATTACCCTGGGTATGGATGAGCTG TATAAATGA |
![](https://static.igem.org/mediawiki/parts/3/34/LacIq%2BsYFP2.png)
Figure 7:The devices used in expression of sYFP2
2.2.2 Main protocols:
Materials:
Enzyme NcoI and BamHI
10xBuffer(NEB buffer 1.1 2.1 3.1 star)
PCR DNA
ddH2O
pIND4 plasmid DNA
Method:
- Configuration of double enzyme digestion system:
- the reaction temperature of 37 ℃ 15min (specific reaction time see the instructions).
- After the end of the reaction 80 ℃ 20min inactivation.
Digestion System(50μL):
NcoI | 1 μL |
BamHI | 1 μL |
10 x Buffer | 5 μL (NEB's buffer score 1.1 2.1 3.1 star specific see enzyme instructions select the cutting efficiency and asterisk the best activity) |
ddH2O | added as appropriate |
DNA | 1 μg |
Materials:
T4 DNA ligase
10x buffer
Plasmid DNA
PCR DNA
ddH2O
Method:
- According to the external source and carrier concentration ratio of 5: 1 configuration connection system 20μL
- 16 ℃for 1 h
- The connection solution to take 10μL to transform, with kanr resistance screening positive bacteria
Ligation System(20μL):
10 x buffer | 2 μL |
T4 DNA ligase | 1 μL |
plasmid DNA | X μL |
PCR DNA | Y μL |
Materials:
10% glycerol
2mm Electroporation cup
Kanr plate
ddH2O
Method:
- 32℃ overnight cμLture and transfer, until the OD grows to about 2.5
- 10 mL of bacteria at 5000 rpm for 5 min to collect all the cells
- 2 mL sterile water pumped retrogradesum (washed away from the medium ion residue, centrifuged at 5000 rpm for 2 min)
- with 200μL 10% glycerol resuspend the bacteria
- 100μL of competent and 100ng plasmid mixed
- by adding 2mm electric rotor 1.5Kv shock (voltage index curve mode, capacitance 25uF, resistance 200Ω)
- 600 μLTSB mixed and moved into the EP tube
- 32℃, 220rpm recovery 2h
- 5000 rpm after centrifugation, remove the 400μL supernatant, the remaining bacteria coated on kanr resistant plate
- cμLture 2-3d observation resμLts
3. Final performance
After obtaining three engineering bacteria, we first examined whether the presence of fluorescence in the fluorescence microscope to determine whether the success of the gene, and through the absorption spectrum to check whether there is an additional 514nm near the absorption peak. Finally, we performed photosynthetic growth curve measurements and hydrogen production experiments to test for additional ATP or H2 production.
Cells were cμLtured in TSB medium. After overnight incubation, the OD700 was 0.02 and then the photosynthetic growth curve of 0-24 h was recorded. The cells were given sufficient oxygen. The light source was white LED lamp or green LED lamp (main wavelength For 520nm), the illuminance parameters measured by the illuminometer are shown below
![](https://static.igem.org/mediawiki/2017/8/86/Ep_8.png)
Figure 8:The illuminance of LED bμLb used in experiment
Materials:
Media for fermentation :
For 1L media:
Succinic acid disodium salt 5.49g
NaCl 0.4g
MgS04·7H20 0.2g
CaCL2·2H20 0.05g
L-glutamate 5mol
KH2PO4 1.0g
K2HPO4 ·2H20 1.572g
Yeast extract fermentation 1.0g
Solution of trace element 1.0 mL
Solution of growth factor 1.0 mL
For 100 mL solution of trace element:
0.21 g MnSO4 · 4H2O
0.28 g H3BO3
0.004 g Cu(NO3)2 · 7H2O,
0.024 g ZnSO4 · 7H2O,
0.075 g Na2MoO4 · 2H2O
For 100 mL solution of growth factor:
0.01g biotin
0.5g thiamine HCl
1.0g nicotinic acid
Main protocol:
- Rhodobacter sphaeroides 2.4.1 were cμLtured in TSB medium for 48h
- Took 10 mL bacterial suspension and removed the clear supernatant extract after demission at 3500rpm for 5 minutes
- Resuspended the bacteria in 10 mL fermentation medium and transferred them into a new conical flask
- Added 90 mL fermentation medium into the flask with 100μL solution of growth factor, 100μL solution of trace element, 30ng/μL kanamycin and 100μL IPTG (making the final concentration 800μL)
- Introduced argon to the flask through rubber tube for 5 min and wrapped the bottleneck with plastic membrane in case of gaseous escape
- Pressed the bottleneck with rubber stopper and sealed it with parafilm
- CμLtured the bacteria in the flask which was exposed to 4,000lx under anaerobic condition with nutrient at 32℃
- Collected the gas based on water gas displacing principle using pinhead through rubber stopper and the pinhead shoμLd be covered with Vaseline
- Drew bacterial suspension with syringe and measured OD every 24 hours. After each measurement, the pinhead shoμLd be covered with Vaseline.
![](https://static.igem.org/mediawiki/2017/9/93/Ep_11.png)
![](https://static.igem.org/mediawiki/2017/a/af/Ep_10.png)