Lukas Adam (Talk | contribs) |
Lukas Adam (Talk | contribs) |
||
Line 480: | Line 480: | ||
<h1 style="text-align: center !important; color:##393939 !important; font-weight: 400 !important;padding: 0px !important; margin: 0px !important"> | <h1 style="text-align: center !important; color:##393939 !important; font-weight: 400 !important;padding: 0px !important; margin: 0px !important"> | ||
2. Get phage</h1> | 2. Get phage</h1> | ||
+ | <div class="col-md-12 col-lg12 col-xs-12"> | ||
+ | Phage-assisted continous evolution is based on the generation of selection phages, | ||
+ | which have geneIII replaced by the gene of interest. For the generation of your own selection phage, | ||
+ | we are offering a golden-gate cloning standard being based on the extraordinary potential of the type IIs restriction enzyme BsaI. | ||
+ | For insertion of your gene of interest into the phage backbone, amplification with primers containing the following overhangs is required: | ||
+ | {{Heidelberg/formblank|Overhangs|#ffd700| | ||
+ | {{#tag:html| | ||
+ | <table class="table"> | ||
+ | <thead><tr class="table-row"><th>Fwd:</th><th>GAGGTCTCGAAAA</th></tr></thead><tbody> | ||
+ | <tr><td>Rev:</td><td>CAGGTCTCGGTGC</td></tr> | ||
+ | </tbody></table> | ||
+ | }} | ||
+ | |}} | ||
+ | |||
+ | Following the successfully performed amplification with these primers, | ||
+ | a golden gate reaction (refering to the golden gate assembly protocol) with the BioBricks BBa_K2398021 and BBa_K2398022 should be performed. | ||
+ | GoldenGate cloning usually delivers good results. In the following of this reaction, | ||
+ | the assembled plasmid should be transformed into electrocompetent S1059 or S2208 cells. | ||
+ | These strains, established by the liu lab, carry a plasmid (pJC175e) that provides geneIII under a psp-promoter. | ||
+ | This promoter gets activated by phage infection, and ensures that geneIII is not present in the uninfected cell. | ||
+ | For further information about the principle of phage propagation, have a look at our RFC (hier Link einfügen) | ||
+ | |||
+ | As an alternative to the assembly with two phage backbone fragments, the golden gate assembly reaction | ||
+ | can be also performed using only the BBa_K2398023 BioBrick. In this case, | ||
+ | amplification of the gene of interest has to be implemented with other overhangs: | ||
+ | |||
+ | |||
+ | {{Heidelberg/formblank|Overhangs|#ffd700| | ||
+ | {{#tag:html| | ||
+ | <table class="table"> | ||
+ | <thead><tr class="table-row"><th>Fwd:</th><th>GTGGTCTCAATGG</th></tr></thead><tbody> | ||
+ | <tr><td>Rev:</td><td>TTGGTCTCAGTTG</td></tr> | ||
+ | </tbody></table> | ||
+ | }} | ||
+ | |}} | ||
+ | |||
+ | If you want to produce your selection phage on your own by using another cloning method, | ||
+ | please keep in mind that the terminator of geneVIII may be immediately followed by the RBS of the evolving gene. | ||
+ | Futhermore, the last 180 bp of geneIII should not be removed, because they contain the promoter for the following operon of phage genes. | ||
+ | In that case, we provide the surrunding sequences of the gene of interest below: | ||
+ | |||
+ | {{Heidelberg/formblank|Additional Sequences|#ffd700| | ||
+ | {{#tag:html| | ||
+ | <table class="table"> | ||
+ | <thead><tr class="table-row"><th>Upstream sequence</th><th>AAAGGCTCCTTTTGGAGCCTTTTTTTT</th></tr></thead><tbody> | ||
+ | <tr><td>Downstream sequence</td><td>CTCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTT</td></tr> | ||
+ | </tbody></table> | ||
+ | }} | ||
+ | |}} | ||
+ | </div> | ||
</div> | </div> | ||
<div class="t-container input-form content" style="position: relative; top: 60px;"> | <div class="t-container input-form content" style="position: relative; top: 60px;"> |
Revision as of 01:00, 2 November 2017