Notebook

31/07/2017, Monday

Filled two Petri dishes with two different antibiotics (chloramphenicol and kanamycin) to test the strains.
As a result,the strains have grown in chloramphenicol successfully.

01/08/2017, Tuesday

Resuspended plasmids from the distribution kit in 20 μl distilled water. Resuspended plasmids:

• BBa_K1351005(plate 5,2H)
• BBa_K1415002(plate 5,13E)
• BBa_K1321105(plate 5,16B)
• BBa_K676002(plate 6,19N)

Transformed competent cells with 5 μl of resuspension(with heat shock).
Heat shock:

• 20 min - ice
• 45 s - 42°
• 2 min - ice

Streaked chloramphenicol agar with 300 μl of transformation reaction.
Transformation reaction: 5μl plasmid + 110 μl cells + 300 μl LB.

02/08/2017, Wednesday

Put night cultures after adding nutrient medium (5 ml - LB) with chloramphenicol (add 1 colony).
Used plasmids:

• BBa_K1351005(plate 5,2H)
• BBa_K1415002(plate 5,13E)
• BBa_K1321105(plate 5,16B)
• BBa_K676002(plate 6,19N)

Concentration of plasmids: 100 pg/μl.

03/08/2017, Thursday

Night cultures of next plasmids:

• BBa_K1351005(plate 5,2H)
• BBa_K1415002(plate 5,13E)
• BBa_K1321105(plate 5,16B)
• BBa_K676002(plate 6,19N)

I. Purification of plasmids for sequencing.
For alkaline lysis were used:

• Tris HCL - 250 μl
• lysing solution - 250 μl
• potassium acetate - 350 μl

For the rest plasmids’ purification:

• isopropanol - 850 μl
• ethanol 80% - 850 μl
• buffer Tris HCL - 60 μl
• reagents for agarose gel electrophoresis

Gel electrophoresis:

• 1. BBa_K1362051 (Intein protease with arabinose inducible regulatory promoter)
• 2. BBa_K1319004 (TEV protease with anti-self cleavage mutation S219V)
• 3. BBa_K1321090 (Phytochelatin (PC) EC20)
• 4. BBa_K300004 (Engineered pH-inducible intein (codon optimized for E. coli) – internal domain)
• 5. Ladder
• 6. Control, some plasmid

II. Resuspended plasmids from the distribution kit in 20 μl distilled water.
Transformed competent cells with 5 μl of resuspension (with heat shock).
Heat shock:

• 20 min - ice
• 90 s - 42°
• 2 min - ice

After adding 200μl SOB - 15-20 min 37°
Streaked chloramphenicol agar with 300 μl of transformation reaction.
Resuspended plasmids:

• BBa_K1362051(plate 5,23I)
• BBa_K1321090(plate 5,12L)
• BBa_K1319004(plate 5,9O)
• BBa_K300004(plate 6,6C)

07/08/2017, Monday

As our previous transformation had bad results, we decided to test other BioBricks with different mass values and ways of transformation.

I. Resuspended plasmids from the distribution kit in 20 μl distilled water.
Transformed competent cells with 5 μl(plate 2,1D) and 10 μl(plate 2,1D and 1B) of resuspension with heat shock and 10 μl of resuspension (plate 2,1B) with electroporation.
Streaked chloramphenicol agar with 300 μl of transformation reaction.
Transformation reaction: 5μl plasmid + 85 μl cells + 200 μl SOB.
Resuspended plasmids:

• BBa_K909007 (plate 2,1B)
• BBa_K777113 (plate 2,1D)

II.Put night cultures after adding nutrient medium (5-6 ml LB) with antibiotic (chloramphenicol), add 1 colony.
Used plasmids:

• BBa_K1319004 (plate 5,9O)
• BBa_K300004 (plate 6,6C)

08/08/2017, Tuesday

Used plasmids:

• BBa_K1319004 (plate 5,9O)
• BBa_K300004 (plate 6,6C)

Purification of plasmids for sequencing.
For alkaline lysis were used:

• Tris HCL - 250 μl
• lysing solution - 250 μl
• potassium acetate - 350 μl

For the rest plasmids’ purification:

• isopropanol - 850 μl
• ethanol 80% - 850 μl
• buffer Tris HCL - 60 μl
• reagents for agarose gel electrophoresis.

09/08/2017, Wednesday

Resuspended plasmids from the distribution kit in 20 μl distilled water.
Transformed competent cells with 5 μl of resuspension(with electroporation).
After adding 800μl SOB - 40 min 37°.
Streaked chloramphenicol agar with 300 μl of transformation reaction.
Transformation reaction: 5μl plasmid + 85 μl cells + 200 μl SOB.

Resuspended plasmids:

• BBa_K1362051 (plate 5,23I)
• BBa_K1321090 (plate 5,12L)
• BBa_K1319004 (plate 5,9O)
• BBa_K300004 (plate 6,6C)

10/08/2017, Thursday

Put night cultures after adding nutrient medium (5-6 ml LB) with antibiotic (chloramphenicol), add 1 colony.
Used plasmids:

• BBa_K1362051 (plate 5,23I)
• BBa_K1321090 (plate 5,12L)
• BBa_K1319004 (plate 5,9O)
• BBa_K300004 (plate 6,6C)

11/08/2017,Friday

Night cultures of plasmids:

• BBa_K1362051(plate 5,23I)
• BBa_K1321090(plate 5,12L)
• BBa_K1319004(plate 5,9O)
• BBa_K300004(plate 6,6C)

Purification of plasmids for sequencing.
For alkaline lysis were used:

• Tris HCL - 250 μl
• lysing solution - 250 μl
• potassium acetate - 350 μl

For the rest plasmids’ purification:

• isopropanol - 850 μl
• ethanol 70% - 850 μl
• ethanol 96% - 850 μl
• buffer Tris HCL - 60 μl
• reagents for agarose gel electrophoresis

17/08/2017, Thursday

pOV-3Op plasmid
TTP-PAG plasmid
Transformed 1 μl of pOV-3Op plasmid and 1 μl of TTP-PAG plasmid(with heat-shock).
Heat-shock:
Streaked ampicillin agar with 286 μl of TTP-PAG’s and pUV-3Op’s transformation reaction.
Transformation reaction: 1μl plasmid + 85 μl cells + 200 μl SOB.

18/08/2017, Friday

I.The TTP-PAG’s transformation results were quite good, but pUV-3Op needed retransformation.
Transformed 1 μl of pUV-3Op plasmid (with electroporation).
Streaked kanamycin agar with 286 μl of pUV-3Op transformation reaction.
Transformation reaction: 1μl plasmid + 85 μl cells + 200 μl SOB.

II.Put night cultures of TTP-PAG after adding nutrient medium with antibiotic to the colony.

19/08/2017, Saturday

Put night cultures of pUV-30p after adding nutrient medium (5-6 ml) with antibiotic (kanamycin), add 1 colony.
Used plasmids:

• TTP-PAG
• pUV-3Op

20/08/2017, Sunday

Purification of plasmids for sequencing.

For alkaline lycis were used:

• isopropanol - 850 μl
• Tris HCL 250 μl
• lysing solution 250 μl
• potassium acetate - 350 μl

For the rest plasmids’ purification:

• isopropanol - 850 μl
• ethanol 70% - 850 μl
• ethanol 96% - 850 μl
• buffer Tris HCL - 60 μl
• reagents for agarose gel electrophoresis

Used plasmids:

• TTP-PAG
• pUV-3Op

28/08/2017, Monday

I. Restriction:

• 3 μl of plasmid
• 1 μl of restrictase BamHI
• 2 μl of 10x buffer
• 14 μl of water

In the second eppendorf add 15 μl of water and no restrictase to compare two tracks and to see the impact of the enzyme on the plasmid.
Put the mixtures in a thermostat, temperature of 37 °C, 30 minutes.

Used plasmids:

• pUV-3Op

II. Agarose gel electrophoresis

30/08/2017, Wednesday

I. PCR
Materials:

• 5x Phusion buffer 20 μl
• nucleotides (final concentration=0.2 μM) 2 μl
• primer BBGlucFor1:GCCCCAGATCTCAGGCCTGTTCTTCCGT (final concentration=1 μM) 10 μl
• primer BBGlucRev1:GGCCGAGATCTGTAAAGACACTGGGAGT (final concentration=1 μM) 10 μl
• matrix(final concentration=30 ng) 1 μl
• polymerase 1.4 μl
• water 60 μl

Total:100 μl

PCR machine programme:

Segment	1	2	3	4
Cycles	1	29	1	1
Temperature	95 °C	1) 95 °С 2) 49 °C 3) 72 °C	49 °C	72 °C
Time	2 min	1) 30 sec 2) 30 sec 3) 40 sec	20 sec	3 min

II.Agarose gel electrophoresis



Cut the track with the DNA and put it to an eppendorf

III.DNA gel Isolation:

• binder solution 600 μl x2(2 ependorfs)
• isopropanol 200 μl x2
• water 40 μl x2
• gel with DNA 200 μg x2
• the wash solution 800 μl x2

Result: concentration - 5 ng/μl
as the concentration is too small we do a rePCR

IV.rePCR:

• nucleotides (final concentration=0.2 μM) 1 μl
• primer BBGlucFor1:GCCCCAGATCTCAGGCCTGTTCTTCCGT (final concentration=1 μM) 5 μl
• primer BBGlucRev1:GGCCGAGATCTGTAAAGACACTGGGAGT (final concentration=1 μM) 5 μl
• matrix(final concentration 3 ng) 3 μl
• 10x buffer 5 μl
• polymerase 0.7 μl
• water 35 μl

total:59.7 μl

V.DNA reprecipitation:

• mixture 59.7 μl
• sodium acetate 5 μl
• alcohol 96% 150 μl
• centrifuge - 15 min (21 °C; 13.2 rpm)
• in thermostat on 37 °C for 10-15 min

31/08/2017, Thursday

I. PCR for vector:

• 10x buffer 5 μl
• primer BBGlucFor1:GCCCCAGATCTCAGGCCTGTTCTTCCGT (final concentration=2 μM) 0.5 μl
• primer BBGlucRev1:GGCCGAGATCTGTAAAGACACTGGGAGT (final concentration=2 μM) 0.5 μl
• matrix 0.5 μl
• polymerase 0.7 μl
• nucleotides 1 μl
• water 42 μl

Total:50 μl

PCR machine programme:

Segment	1	2	3	4
Cycles	1	17	1	1
Temperature	95 °C	1) 95 °С 2) 49 °C 3) 72 °C	49 °C	72 °C
Time	2 min	1) 30 sec 2) 30 sec 3) 40 sec	20 sec	3 min

II.DNA reprecipitation

• mixture 50 μl
• sodium acetate 5 μl
• alcohol 96% 150 μl
• centrifuge - 15 min (21 °C;13.2 rpm)
• put in thermostat on 37 °C for 10-15 min

DNA concentration=188,8 ng/μl

III.Agarose gel electrophoresis

IV.Restriction

eppendorf	1	2	3
	restrictase BamH1 1.5 μl vector 10 μl 10x buffer 5 μl water 33.5 μl	restrictase BamH1 1.5 μl insert 42 μl 10x buffer 5 μl water 33.5 μl	restrictase BamH1 1.5 μl vector with phosphatase 10 μl 10x buffer 5 μl water 33.5 μl

• put in thermostat on 37 °C for 30 min

V.DNA isolation:

• binder solution 250 μl x2(on two ependorfs)
• isopropanol 125 μl x2
• the reaction mixture 50 μl x2
• the wash solution 700 μl x2

DNA Concentration:

• vector-19.9 ng/μl
• vector with phosphatase-13.5 ng/μl
• insert-62.7 ng/μl

VI.Agarose gel electrophoresis

VII.Ligation:

eppendorf	1(vector)	2(vector with phosphatase)
10x buffer	1 μl	1 μl
vector	0.5 μl	0.5 μl
insert	5 μl	5 μl
water	3.5 μl	3.5 μl
ligase	1 μl	1 μl

• leave the eppendorfs overnight in the thermostat on 14 °C

01/09/2017, Friday

I.Vector restriction check: agarose gel electrophoresis(150 w)

• marker 4 μl(concentration:25 ng/μl)
• gel-1.5 %

II. Transformed competent cells(XL1Blue) with 3 μl of ligate
With electroporation:shock 3-5 sec
Wash with SOB 1000 μl
Put eppendorfs to shaker on 1 hour
Transformation reaction - 1045 μl

III.Streaked with kanamycin agar with 50 μl of transformation reaction
Wring the solution, take 900 µl of supernatant ,mix it
Streaked with kanamycin agar with the rest of the transformation reaction(50 μl)

Put eppendorfs to the thermostat for night

03/09/2017, Monday

Nothing has grown

04/09/2017, Tuesday

I.Ligate reprecipitation:

• ligate of vector - 7 μl
• co-precipitator 5xSatellite red - 1 μl
• NaAC - 0.7 μl
• EtOH 97% - 21 μl
• centrifugation - 15 min on 4 °C
• to the thermostat on 37 °C

II.Ligation:

• vector with phosphatase - 2.5 μl
• 10x buffer - 2 μl
• ligase santific thermo fisher - 2 μl
• water - 3.5 μl

the total volume of the reaction:20 μl
leave the eppendorfs overnight in thermostat on 14 °C

05/09/2017, Wednesday

I.Transformed 45 μl of competent cells(XL1Blue) with vector,vector with phosphatase and for control:plasmid EVST yellow fluorescently(4.5 KB)
With electroporation:shock - 3-5 sec
Add 4 μl of concentrated ligate(after reprecipitation) and repeat electroporation
Wash with SOB 1000 μl
Put eppendorfs to shaker on 1 hour

II.Streaked with kanamycin agar with 300 μl of transformation reaction(50 μl of cells and 250 μl of SOB) ->4 petri dishes

06/09/2017, Thursday

I.PCR
materials:

• primer 1 -0.2 μl
• primer 2 - 0.2 μl
• control(agar without colonies)
• Screen mix 5x - 2 μl for reaction
• water - 7.6 μl
• 20 reaction volumes + 2 extra volumes

PCR machine programme:

Segment	1	2	3	4
Cycles	1	18	1	1
Temperature	94 °C	1) 94 °С 2) 49 °C 3) 82 °C	49 °C	82 °C
Time	2 min	1) 30 sec 2) 20 sec 3) 25 sec	20 sec	3 min

II.Agarose gel electrophoresis(160 w):

• gel-1.5 %

Result:negative

III.rePCR

Segment	1	2	3	4
Cycles	1	4	1	1
Temperature	94 °C	1) 94 °С 2) 49 °C 3) 82 °C	49 °C	82 °C
Time	2 min	1) 30 sec 2) 20 sec 3) 25 sec	20 sec	3 min

IV.Agarose gel electrophoresis

Result:negative(ligase could die in the freezing)

We decided to develop a lot of vector and insert to put a restriction and ligation with a normal volume

V.PCR of insert: materials:

• buffer - 10 μl
• nucleotides - 2 μl
• matrix (20 ng/μl) - 0.5 μl
• primers - 10 μl x2 (10 μM)
• MQ - 66 μl
• Tersus of polymerase - 1.4 μl

total:50 μl x2 (100 μl)

PCR machine programme:

Segment	1	2	3	4
Cycles	1	17	1	1
Temperature	94 °C	1) 94 °С 2) 49 °C 3) 82 °C	49 °C	82 °C
Time	2 min	1) 30 sec 2) 20 sec 3) 25 sec	20 sec	3 min

VI.Reprecipitation ligate:

• ligate - 20 μl
• co-precipitator Satellite red - 1 μl
• NaAC - 2 μl
• EtOH 97% - 60 μl
• centrifugation - 15 min
• to the thermostat on 37 °C

Used:

• ligate transformation - 4 μl
• source vector for further developments - 2 μl

Unfortunately,the results weren’t good again

VII.PCR screen(petri dish with biobrick C3)
8 pieces - negative

VIII. Transformed 1 μl of pUV-3Op plasmid (with electroporation) Streaked kanamycin agar with 286 μl of pUV-3Op transformation reaction. Transformation reaction: 1μl plasmid + 85 μl cells + 200 μl SOB. Put night cultures of pUV-3Op

IX.Plasmid selection:

• liquid medium - 50 μl
• twist in flacons(50 μl)
• take away the supernatant
• binder solution - 2 ml on 100 ml of cells
• neutralizing solution - 750 μl
• the wash solution - 500 μl
• centrifugation 15 min