Team:Moscow RF/notebook
Notebook
31/07/2017, Monday
Filled two Petri dishes with two different antibiotics (chloramphenicol and kanamycin) to test the strains.
As a result,the strains have grown in chloramphenicol successfully.
01/08/2017, Tuesday
Resuspended plasmids from the distribution kit in 20 μl distilled water. Resuspended plasmids:
- BBa_K1351005(plate 5,2H)
- BBa_K1415002(plate 5,13E)
- BBa_K1321105(plate 5,16B)
- BBa_K676002(plate 6,19N)
Transformed competent cells with 5 μl of resuspension(with heat shock).
Heat shock:
- 20 min - ice
- 45 s - 42°
- 2 min - ice
Streaked chloramphenicol agar with 300 μl of transformation reaction.
Transformation reaction: 5μl plasmid + 110 μl cells + 300 μl LB.
02/08/2017, Wednesday
Put night cultures after adding nutrient medium (5 ml - LB) with chloramphenicol (add 1 colony).
Used plasmids:
- BBa_K1351005(plate 5,2H)
- BBa_K1415002(plate 5,13E)
- BBa_K1321105(plate 5,16B)
- BBa_K676002(plate 6,19N)
Concentration of plasmids: 100 pg/μl.
03/08/2017, Thursday
Night cultures of next plasmids:
- BBa_K1351005(plate 5,2H)
- BBa_K1415002(plate 5,13E)
- BBa_K1321105(plate 5,16B)
- BBa_K676002(plate 6,19N)
I. Purification of plasmids for sequencing.
For alkaline lysis were used:
- Tris HCL - 250 μl
- lysing solution - 250 μl
- potassium acetate - 350 μl
For the rest plasmids’ purification:
- isopropanol - 850 μl
- ethanol 80% - 850 μl
- buffer Tris HCL - 60 μl
- reagents for agarose gel electrophoresis
Gel electrophoresis:
- 1. BBa_K1362051 (Intein protease with arabinose inducible regulatory promoter)
- 2. BBa_K1319004 (TEV protease with anti-self cleavage mutation S219V)
- 3. BBa_K1321090 (Phytochelatin (PC) EC20)
- 4. BBa_K300004 (Engineered pH-inducible intein (codon optimized for E. coli) – internal domain)
- 5. Ladder
- 6. Control, some plasmid
II. Resuspended plasmids from the distribution kit in 20 μl distilled water.
Transformed competent cells with 5 μl of resuspension (with heat shock).
Heat shock:
- 20 min - ice
- 90 s - 42°
- 2 min - ice
After adding 200μl SOB - 15-20 min 37°
Streaked chloramphenicol agar with 300 μl of transformation reaction.
Resuspended plasmids:
- BBa_K1362051(plate 5,23I)
- BBa_K1321090(plate 5,12L)
- BBa_K1319004(plate 5,9O)
- BBa_K300004(plate 6,6C)
07/08/2017, Monday
As our previous transformation had bad results, we decided to test other BioBricks with different mass values and ways of transformation.
I. Resuspended plasmids from the distribution kit in 20 μl distilled water.
Transformed competent cells with 5 μl(plate 2,1D) and 10 μl(plate 2,1D and 1B) of resuspension with heat shock and 10 μl of resuspension (plate 2,1B) with electroporation.
Streaked chloramphenicol agar with 300 μl of transformation reaction.
Transformation reaction: 5μl plasmid + 85 μl cells + 200 μl SOB.
Resuspended plasmids:
- BBa_K909007 (plate 2,1B)
- BBa_K777113 (plate 2,1D)
II.Put night cultures after adding nutrient medium (5-6 ml LB) with antibiotic (chloramphenicol), add 1 colony.
Used plasmids:
- BBa_K1319004 (plate 5,9O)
- BBa_K300004 (plate 6,6C)
08/08/2017, Tuesday
Used plasmids:
- BBa_K1319004 (plate 5,9O)
- BBa_K300004 (plate 6,6C)
Purification of plasmids for sequencing.
For alkaline lysis were used:
- Tris HCL - 250 μl
- lysing solution - 250 μl
- potassium acetate - 350 μl
For the rest plasmids’ purification:
- isopropanol - 850 μl
- ethanol 80% - 850 μl
- buffer Tris HCL - 60 μl
- reagents for agarose gel electrophoresis.
09/08/2017, Wednesday
Resuspended plasmids from the distribution kit in 20 μl distilled water.
Transformed competent cells with 5 μl of resuspension(with electroporation).
After adding 800μl SOB - 40 min 37°.
Streaked chloramphenicol agar with 300 μl of transformation reaction.
Transformation reaction: 5μl plasmid + 85 μl cells + 200 μl SOB.
Resuspended plasmids:
- BBa_K1362051 (plate 5,23I)
- BBa_K1321090 (plate 5,12L)
- BBa_K1319004 (plate 5,9O)
- BBa_K300004 (plate 6,6C)
10/08/2017, Thursday
Put night cultures after adding nutrient medium (5-6 ml LB) with antibiotic (chloramphenicol), add 1 colony.
Used plasmids:
- BBa_K1362051 (plate 5,23I)
- BBa_K1321090 (plate 5,12L)
- BBa_K1319004 (plate 5,9O)
- BBa_K300004 (plate 6,6C)
11/08/2017,Friday
Night cultures of plasmids:
- BBa_K1362051(plate 5,23I)
- BBa_K1321090(plate 5,12L)
- BBa_K1319004(plate 5,9O)
- BBa_K300004(plate 6,6C)
Purification of plasmids for sequencing.
For alkaline lysis were used:
- Tris HCL - 250 μl
- lysing solution - 250 μl
- potassium acetate - 350 μl
For the rest plasmids’ purification:
- isopropanol - 850 μl
- ethanol 70% - 850 μl
- ethanol 96% - 850 μl
- buffer Tris HCL - 60 μl
- reagents for agarose gel electrophoresis
17/08/2017, Thursday
pOV-3Op plasmid
TTP-PAG plasmid
Transformed 1 μl of pOV-3Op plasmid and 1 μl of TTP-PAG plasmid(with heat-shock).
Heat-shock:
Streaked ampicillin agar with 286 μl of TTP-PAG’s and pUV-3Op’s transformation reaction.
Transformation reaction: 1μl plasmid + 85 μl cells + 200 μl SOB.
18/08/2017, Friday
I.The TTP-PAG’s transformation results were quite good, but pUV-3Op needed retransformation.
Transformed 1 μl of pUV-3Op plasmid (with electroporation).
Streaked kanamycin agar with 286 μl of pUV-3Op transformation reaction.
Transformation reaction: 1μl plasmid + 85 μl cells + 200 μl SOB.
II.Put night cultures of TTP-PAG after adding nutrient medium with antibiotic to the colony.
19/08/2017, Saturday
Put night cultures of pUV-30p after adding nutrient medium (5-6 ml) with antibiotic (kanamycin), add 1 colony.
Used plasmids:
- TTP-PAG
- pUV-3Op
20/08/2017, Sunday
Purification of plasmids for sequencing.
For alkaline lycis were used:
- isopropanol - 850 μl
- Tris HCL 250 μl
- lysing solution 250 μl
- potassium acetate - 350 μl
For the rest plasmids’ purification:
- isopropanol - 850 μl
- ethanol 70% - 850 μl
- ethanol 96% - 850 μl
- buffer Tris HCL - 60 μl
- reagents for agarose gel electrophoresis
Used plasmids:
- TTP-PAG
- pUV-3Op
28/08/2017, Monday
I. Restriction:
- 3 μl of plasmid
- 1 μl of restrictase BamHI
- 2 μl of 10x buffer
- 14 μl of water
In the second eppendorf add 15 μl of water and no restrictase to compare two tracks and to see the impact of the enzyme on the plasmid.
Put the mixtures in a thermostat, temperature of 37 °C, 30 minutes.
Used plasmids:
- pUV-3Op
II. Agarose gel electrophoresis
30/08/2017, Wednesday
I. PCR
Materials:
- 5x Phusion buffer 20 μl
- nucleotides (final concentration=0.2 μM) 2 μl
- primer BBGlucFor1:GCCCCAGATCTCAGGCCTGTTCTTCCGT (final concentration=1 μM) 10 μl
- primer BBGlucRev1:GGCCGAGATCTGTAAAGACACTGGGAGT (final concentration=1 μM) 10 μl
- matrix(final concentration=30 ng) 1 μl
- polymerase 1.4 μl
- water 60 μl
Total:100 μl
PCR machine programm:
| Segment | 1 | 2 | 3 | 4 |
| Cycles | 1 | 29 | 1 | 1 |
| Temperature | 95 °C | 1) 95 °С 2) 49 °C 3) 72 °C | 49 °C | 72 °C |
| Time | 2 min | 1) 30 sec 2) 30 sec 3) 40 sec | 20 sec | 3 min |
II.Agarose gel electrophoresis
Cut the track with the DNA and put it to an eppendorf
III.DNA gel Isolation:
- binder solution 600 μl x2(2 ependorfs)
- isopropanol 200 μl x2
- water 40 μl x2
- gel with DNA 200 μg x2
- the wash solution 800 μl x2
Result: concentration - 5 ng/μl
as the concentration is too small we do a rePCR
IV.rePCR:
- nucleotides (final concentration=0.2 μM) 1 μl
- primer BBGlucFor1:GCCCCAGATCTCAGGCCTGTTCTTCCGT (final concentration=1 μM) 5 μl
- primer BBGlucRev1:GGCCGAGATCTGTAAAGACACTGGGAGT (final concentration=1 μM) 5 μl
- matrix(final concentration 3 ng) 3 μl
- 10x buffer 5 μl
- polymerase 0.7 μl
- water 35 μl
total:59.7 μl
V.DNA reprecipitation:
- mixture 59.7 μl
- sodium acetate 5 μl
- alcohol 96% 150 μl
- centrifuge - 15 min (21 °C; 13.2 rpm)
- in thermostat on 37 °C for 10-15 min
31/08/2017, Thursday
I. PCR for vector:
- 10x buffer 5 μl
- primer BBGlucFor1:GCCCCAGATCTCAGGCCTGTTCTTCCGT (final concentration=2 μM) 0.5 μl
- primer BBGlucRev1:GGCCGAGATCTGTAAAGACACTGGGAGT (final concentration=2 μM) 0.5 μl
- matrix 0.5 μl
- polymerase 0.7 μl
- nucleotides 1 μl
- water 42 μl
Total:50 μl
PCR machine programm:
| Segment | 1 | 2 | 3 | 4 |
| Cycles | 1 | 17 | 1 | 1 |
| Temperature | 95 °C | 1) 95 °С 2) 49 °C 3) 72 °C | 49 °C | 72 °C |
| Time | 2 min | 1) 30 sec 2) 30 sec 3) 40 sec | 20 sec | 3 min |
II.DNA reprecipitation
- mixture 50 μl
- sodium acetate 5 μl
- alcohol 96% 150 μl
- centrifuge - 15 min (21 °C;13.2 rpm)
- put in thermostat on 37 °C for 10-15 min
DNA concentration=188,8 ng/μl
III.Agarose gel electrophoresis
IV.Restriction
| eppendorf | 1 | 2 | 3 |
|
|
|
- put in thermostat on 37 °C for 30 min
V.DNA isolation:
- binder solution 250 μl x2(on two ependorfs)
- isopropanol 125 μl x2
- the reaction mixture 50 μl x2
- the wash solution 700 μl x2
DNA Concentration:
- vector-19.9 ng/μl
- vector with phosphatase-13.5 ng/μl
- insert-62.7 ng/μl
VI.Agarose gel electrophoresis
VII.Ligation:
| eppendorf | 1(vector) | 2(vector with phosphatase) |
| 10x buffer | 1 μl | 1 μl |
| vector | 0.5 μl | 0.5 μl |
| insert | 5 μl | 5 μl |
| water | 3.5 μl | 3.5 μl |
| ligase | 1 μl | 1 μl |
- leave the eppendorfs overnight in the thermostat on 14 °C
01/09/2017, Friday
I.Vector restriction check: agarose gel electrophoresis(150 w)
- marker 4 μl(concentration:25 ng/μl)
- gel-1.5 %
II. Transformed competent cells(XL1Blue) with 3 μl of ligate
With electroporation:shock 3-5 sec
Wash with SOB 1000 μl
Put eppendorfs to shaker on 1 hour
Transformation reaction - 1045 μl
III.Streaked with kanamycin agar with 50 μl of transformation reaction
Wring the solution, take 900 µl of supernatant ,mix it
Streaked with kanamycin agar with the rest of the transformation reaction(50 μl)
Put eppendorfs to the thermostat for night
03/09/2017, Sunday
Nothing has grown
04/09/2017, Monday
I.Ligate reprecipitation:
- ligate of vector - 7 μl
- co-precipitator 5xSatellite red - 1 μl
- NaAC - 0.7 μl
- EtOH 97% - 21 μl
- centrifugation - 15 min on 4 °C
- to the thermostat on 37 °C
II.Ligation:
- vector with phosphatase - 2.5 μl
- 10x buffer - 2 μl
- ligase santific thermo fisher - 2 μl
- water - 3.5 μl
the total volume of the reaction:20 μl
leave the eppendorfs overnight in thermostat on 14 °C
05/09/2017, Thuesday
I.Transformed 45 μl of competent cells(XL1Blue) with vector,vector with phosphatase and for control:plasmid EVST yellow fluorescently(4.5 KB)
With electroporation:shock - 3-5 sec
Add 4 μl of concentrated ligate(after reprecipitation) and repeat electroporation
Wash with SOB 1000 μl
Put eppendorfs to shaker on 1 hour
II.Streaked with kanamycin agar with 300 μl of transformation reaction(50 μl of cells and 250 μl of SOB) ->4 petri dishes
06/09/2017, Thursday
I.PCR:
Control PCR with the cells from the medium (toothpick smear from agar without colonies).
Total amount of samples - 18, also negative and positive controls.
For each sample:
V = 10 μl
Evrogen Screen mix 5x = 2 μl
mQ = 7.6 μl
primers:
forward (10 mM) = 0.2 μl
reverse (10 mM) = 0.2 μl
PCR machine programm:
| Segment | 1 | 2 | 3 | 4 |
| Cycles | 1 | 18 | 1 | 1 |
| Temperature | 94 °C | 1) 94 °С 2) 49 °C 3) 82 °C | 49 °C | 82 °C |
| Time | 2 min | 1) 30 sec 2) 20 sec 3) 25 sec | 20 sec | 3 min |
II.Agarose gel electrophoresis(160 w):
- gel-1.5 %
Result:negative
III.rePCR
| Segment | 1 | 2 | 3 | 4 |
| Cycles | 1 | 4 | 1 | 1 |
| Temperature | 94 °C | 1) 94 °С 2) 49 °C 3) 82 °C | 49 °C | 82 °C |
| Time | 2 min | 1) 30 sec 2) 20 sec 3) 25 sec | 20 sec | 3 min |
IV.Agarose gel electrophoresis
Result:negative(ligase could die in the freezing)
We decided to develop a lot of vector and insert to put a restriction and ligation with a normal volume
V.PCR of insert: materials:
- buffer - 10 μl
- nucleotides - 2 μl
- matrix (20 ng/μl) - 0.5 μl
- primers - 10 μl x2 (10 μM)
- MQ - 66 μl
- Tersus of polymerase - 1.4 μl
total:50 μl x2 (100 μl)
PCR machine programm:
| Segment | 1 | 2 | 3 | 4 |
| Cycles | 1 | 17 | 1 | 1 |
| Temperature | 94 °C | 1) 94 °С 2) 49 °C 3) 82 °C | 49 °C | 82 °C |
| Time | 2 min | 1) 30 sec 2) 20 sec 3) 25 sec | 20 sec | 3 min |
VI.Reprecipitation ligate:
- ligate - 20 μl
- co-precipitator Satellite red - 1 μl
- NaAC - 2 μl
- EtOH 97% - 60 μl
- centrifugation - 15 min
- to the thermostat on 37 °C
Used:
- ligate transformation - 4 μl
- source vector for further developments - 2 μl
Unfortunately,the results weren’t good again
VII.PCR screen(petri dish with biobrick C3)
8 pieces - negative
VIII. Transformed 1 μl of pUV-3Op plasmid (with electroporation)
Streaked kanamycin agar with 286 μl of pUV-3Op transformation reaction.
Transformation reaction: 1μl plasmid + 85 μl cells + 200 μl SOB.
Put night cultures of pUV-3Op
IX.Plasmid purification:
- liquid medium - 50 μl
- spin in tube(50 μl)
- take away the supernatant
- binder solution - 2 ml on 100 ml of cells
- neutralizing solution - 750 μl
- the wash solution - 500 μl
- centrifugation 15 min
07/09/2017, Thursday
I.Plasmid purification:
- liquid medium - 80 ml
- spin in tubes
- take away the supernatant
- binder solution - 2ml on 100 ml of cells
- neutralizing solution - 750 μl
- the wash solution - 500 μl
- centrifugation 15 min
- ligat of each vector spin 2 times for 30 min
- to wash 700 μl wash solution
- spin
- add 50 μl of water and leave for a minute
- spin
II.The PCR of 150 μl of insert(result):
12/09/2017, Tuesday
I.the PCR products reprecipitation:
- PCR-products - 150 μl
- sodium acetate 10% - 15 μl
- alcohol 3:1 volume - 450 μl
- to spin for 15 min on 13.2 cph
- to select supernatant
- to put into the thermostat on 37 °C(10 min)
- to dissolve in 50 μl of water
1.PUV3Op after restriction
2.basic PUV3Op
II.Agarose gel electrophoresis:
- insert - 1 μl
- 1 Kb Ladder - 4 μl
- 100 b Ladder - 4 μl
Result: NanoDrop:
- insert - 550 ng/μl(total:50 μl)
- vector - 340 ng/μl
III.Restriction
| Restrictively DNA | vector(pUV3Op) | insert(phytase) |
| 10x buffer FD | 10 μl | 10 μl |
| restrictase | BamH1 - 4 μl | Bgl2 - 4 μl |
| alkaline phosphatase | 4 μl | - |
| DNA | 30 μl | 18 μl |
| MQ(deionized water) | 52 μl | 68 μl |
| total volume | 100 μl | 100 μl |
- put into the thermostat on 37 °C for 30 min
IV.Agarose gel electrophoresis
V.Restrict allocation on the columns
- 5 volumes of binder solution to 1 volume of reaction mixture
- isopropanol - 250 μl(to the restrict of insert)
- put into the collection tube and centrifuge for 30 sec(maximum speed)
- replace the filtrate
(maximum volume of column-800 μl;after each application of an aliquot the eppendorf needs centrifugation)
- 700 μl of wash solution
- centrifuge 30 sec
- replace the filtrate
- centrifuge empty column for 60 sec for the full replacement off the wash solution
- put the column to another eppendorf
- 30 μ of water to the centre of membrane
- centrifuge for 30 sec
- replace the filtrate
- re-apply the aluate on the column
- centrifuge for 30 sec
The concentrations: of vector=77 ng/μl
of insert=215 ng/μl
VI.The ligation of restriction product:
- vector- 1 μl
- insert - 28 μl
- buffer - 5 μl
- MQ - 11 μl
total:50 μl
14/09/2017, Thursday
I.Ligat reprecipation:
- water - 30 μl
- SattelineRed - 2 μl
- PCR products - 50 μl
- sodium acetate - 5 μl
- EtOH - 150 μl
- to spin for 15 min on 13.2 cph
- to replace supernatant
- to put into the thermostat for 10 min
- to dissolve in 50 μl of water
I.Ligat transformation into cells:
- ligat - 3 μl
- competent cells XL1Blue - 45 μl
- with electroporation
- SOB - 1000 μl
Streaked kanamycin agar with 50 μl of initial mixture(1 petri dish) and 50 μl of 100 times concentrated mixture.
15/09/2017, Friday
Result:on the 1 petri dish 20 colonies have grown,on the 2 - 300 colonies
I.PCR with primers of insert:
1-40 colonies
K(-) control - :4 sm touch of petri dish
K(+) control +:0.2 μl of ligat
V=10 μl
- Screen mix 5x-2 μl on reaction
- water - 7.6 μl
- primer 1 - 0.2 μl
- primer 2 - 0.2 μl
PCR machine programm:
| Segment | 1 | 2 | 3 |
| Cycles | 1 | 22 | 1 |
| Temperature | 94 °C | 1)94 °C 2)49 °C 3)72 °C | 72 °C |
| Time | 2 min | 1)30 sec 2)20 sec 3)30 sec | 1 min |
II.Plasmid purification:
- liquid medium - 80 μl
- spin in tube - 50 ml
- take away the supernatant
- binder solution - 0.5 μl on 15 ml of cells
- lysing solution - 500 μl
- neutralizing solution - 750 μl
- centrifugation for 15 min
- spin every ligat 2 times for 30 min
- wash 700 μl of neutralizing solution
- replace liquid from the collection tubef
- spin
- change the collection tube
- water - 15 μl
- spin for 30 sec on maximum speed
- apply the eluate to the column and re-centrifuge
concentration of vector colonies:
| № | ng/ μl |
| 6 | 1400 |
| 9 | 840 |
| 18 | 970 |
| 20 | 1300 |
| 32 | 1200 |
| 34 | 2250 |
| 36 | 880 |
| 38 | 1000 |
III.Agarose gel electrophoresis:
- samples - 2 μl
- ladder - 4 μl
sequencing:
result:sequencing has shown that our insert has embedded in another vector(pTagYFP-C).It can be explained with the possibility of accidental interference of the cells with another vector of resistance to kanamycin during re-building plasmids
28/09/2017, Thursday
I.Obtaining vector:
The vector was re-established in XL1Blue competent cells and selected as described.
II.re-PCR of insert as described above
III.Restriction of vector and insert:
- primer 1 -0.2 μl
- primer 2 - 0.2 μl
- control(agar without colonies)
- Screen mix 5x - 2 μl for reaction
- water - 7.6 μl
- 20 reaction volumes + 2 extra volumes
| Restricted DNA | Vector(PUV-3Op) | Insert(phytase) |
| 10x buffer FD | 5 μl | 5 μl |
| Restrictases | 2,5 μl(bamH1) | 2,5 μl(Bgl2) |
| Alkaline phosphatase | 2,5 μl | - |
| DNA | 15 μl | 15 μl |
| MQ | 25 μl | 27,5 μl |
| V total | 50 μl | 50 μl |
IV.Ligation:
- vector 200 ng(1 μl)
- insert 2000 ng(7 μl)
- ligase T4 DNA Ligase 1 U/μl(1 μl)
V total:10 μl
Without DNA isolation
03/10/2017, Tuesday
I.Transformation:
Transformed 3 μl of ligat (with electroporation)
Streaked kanamycin agar with 1048 μl of ligat transformation reaction.
Transformation reaction: 3 μl of ligat + 45 μl cells + 1000 μl SOB.
- to put into the shaker on an hour
- to spin for 15 sec at maximum speed
- to take away the 1000 μl of supernatant
- to spread the residue of the reaction on the Petri dish(kanamycin agar)
04/10/2017, Friday
I.PCR-screening colonies:
- 1-20 colonies from the dish A
- K+ - (+) control - 0,2 μl of ligat
| For one reaction | Master mix | |
| Scrin mix 5x | 2 μl | 44 μl |
| mQ | 7,6 μl | 162,7 μl |
| Primers BBGlucFor1 and ConstrRev | 0,2 μl + 0,2 μl | 4,4 μl + 4,4 μl |
| V total | 10 μl | 220 μl |
PCR machine programm:
| Segment | 1 | 2 | 3 | 4 |
| Cycles | 1 | 2 | 20 | 1 |
| Temperature | 94 °C | 1)94 °C 2)46 °C 3)72 °C | 1)94 °C 2)48 °C 3)72 °C | 72 °C |
| Time | 2 min | 1)30 sec 2)20 sec 3)1 min 30 sec | 1)30 sec 2)20 sec 3)1 min 30 sec | 2 min |
II.Agarose gel electrophoresis of PCR-products:
- samples - 2 μl
- ladder - 4 μl
colonies with a positive result:2,9,10
05/10/2017, Saturday
I.Plasmid purification of the 2,9,10 colonies:
- liquid medium - 80 μl
- spin in tubes (50 ml)
- take away the supernatant
- binder solution - 0.5 μl on 15 ml of cells
- lysing solution - 500 μl
- neutralizing solution - 750 μl
- centrifugation for 15 min
- spin every ligat 2 times for 30 min
- wash 700 μl of neutralizing solution
- replace liquid from the collection tube
- spin
- change the collection tube
- water - 30 μl
- spin for 30 sec on maximum speed
- apply the eluate to the column and re-centrifuge for 30 sec
09/10/2017, Monday
I.Additional PCR-screening colonies:
As we had only 3 colonies after the previous PCR-screening, we decided to repeat the procedure.
- a1-a20 colonies from the dish A
- K+ - (+) control - 0,2 μl of ligat
V = 10 μl
| For one reaction | Master mix | |
| Scrin mix 5x | 2 μl | 44 μl |
| MQ | 7,6 μl | 162,7 μl |
| Primers BBGlucFor1 and ConstrRev | 0,2 μl + 0,2 μl | 4,4 μl + 4,4 μl |
| V total | 10 μl | 220 μl |
PCR machine programm:
| Segment | 1 | 2 | 3 | 4 |
| Cycles | 1 | 2 | 20 | 1 |
| Temperature | 94 °C | 1)94 °C 2)46 °C 3)72 °C | 1)94 °C 2)48 °C 3)72 °C | 72 °C |
| Time | 2 min | 1)30 sec 2)20 sec 3)1 min 30 sec | 1)30 sec 2)20 sec 3)1 min 30 sec | 2 min |
II.Agarose gel electrophoresis of PCR-products:
- samples - 2 μl
- ladder - 4 μl
colonies with a positive result:a1,a13,a20
10/10/2017, Tuesday
I.Build Up colonies(a1,a13,a20):
in 15 μl of LB with kanamycin
11/10/2017, Wednesday
I.Plasmid purification of the a1,a13,a20 colonies:
- liquid medium - 80 μl
- spin in tubes (50 ml)
- throw away the supernatant
- binder solution - 0.5 μl on 15 ml of cells
- remove to the 2 μl tube
- lysis buffer - 500 μl
- neutralizing solution - 750 μl
- centrifugation for 15 min
- spin every ligat 2 times for 30 min
- wash 700 μl of neutralizing buffer
- replace liquid from the collection tube
- spin
- change the collection tube
- water - 30 μl
- spin for 30 sec on maximum speed
- apply the eluate to the column and re-centrifuge for 30 sec
Determination of the concentration of selected plasmids on the spectrophotometer:
| № | ng/μl |
| 1 | 1118 |
| 2 | 1044 |
| 3 | 1048 |
18/10/2017, Wednesday
I.the DNA was given to the transformation in yeast Yarrowia lipolytica
II. Preparation of an agarose gel:
- phytate sodium, 2%(200 mM)
- tris-acetate buffer (pH 5,5),with 1% of agarose
- CaCl2 (calcium chloride)-5 %
- pour indicator medium into the Petri dishes(25 μl of medium on Petri dish with 9 sm in diameter)
- punch 15 holes in agarose gel with medium with a diameter of 5 mm
- pour the control samples
the control: 4, 16, 64 times dilution and a sample without dilution
- 1,2,4 - sample 11
- 3,8,12 - sample 13
- 5,6,7 - sample 14
- 9,10,11 - sample 15
- 13,14,15 - sample 16
23/10/2017, Monday
I. Preparation of an agarose gel:
- phytate sodium, 2%(200 mM)
- tris-acetate buffer(pH 5,5),with 1 % of agarose
- CaCl2 (calcium chloride)-5 %
- pour indicator medium into the Petri dishes(25 μl of medium on Petri dish with 9 sm in diameter)
- punch 15 holes in agarose gel with medium with a diameter of 5 mm
- pour the studied samples (with modified and original phytase, heat before and after cell destruction)
Control
Positive result:6 holes with studied samples
(For more details, see the page “Demonstration”)
24/10/2017, Tuesday
I.Cloning biobricks 2488000 and 2488002:
Biobricks were cloned with the restriction sites Spel and Pstl, as the instructions posted on the IGEM website were misunderstood.
Restriction sites were introduced into the structure with PCR using synthetic primers.
II.Cloning biobrick 2488001:
Biobrick was cloned using Gibson Assembly MasterMix and synthetic primers created especially for this purpose.
