Line 91: | Line 91: | ||
window.setTimeout(closeMenuDiv,100); | window.setTimeout(closeMenuDiv,100); | ||
window.setTimeout(closeMenuDiv,200); | window.setTimeout(closeMenuDiv,200); | ||
+ | window.setTimeout(closeMenuDiv,1000); | ||
+ | window.setTimeout(closeMenuDiv,10000); | ||
</script> | </script> | ||
</head> | </head> | ||
<body> | <body> | ||
− | <div class="mdl-layout mdl-js-layout mdl-layout--fixed-header" class="main view"> | + | <div class="mdl-layout mdl-js-layout mdl-layout--fixed-header" class="main view" style="background:#f9f9f9"> |
<div class="android-header mdl-layout__header mdl-layout__header--waterfall"> | <div class="android-header mdl-layout__header mdl-layout__header--waterfall"> | ||
Line 176: | Line 178: | ||
<a name="top"></a> | <a name="top"></a> | ||
<div class="mdl-typography--text-center" style="margin-bottom:20%"> | <div class="mdl-typography--text-center" style="margin-bottom:20%"> | ||
− | <div class="logo-font android-slogan" style="color:# | + | <div class="logo-font android-slogan" style="color:#388E3C;">InterLab</div> |
<div class="logo-font android-sub-slogan" style="color:#757575;">We partecipated in the 4<sup>th</sup> iGEM Interlab study along with about 100 teams. We have focused on quantifying the expression of GFP in common, comparable or absolute units.</div> | <div class="logo-font android-sub-slogan" style="color:#757575;">We partecipated in the 4<sup>th</sup> iGEM Interlab study along with about 100 teams. We have focused on quantifying the expression of GFP in common, comparable or absolute units.</div> | ||
Line 186: | Line 188: | ||
</div> | </div> | ||
<!-- Background and Design --> | <!-- Background and Design --> | ||
− | <div class="demo-card-wide mdl-card mdl-shadow--2dp"> | + | <div class="demo-card-wide mdl-card mdl-shadow--2dp" style="border-radius:10px"> |
<div class="mdl-card__title"> | <div class="mdl-card__title"> | ||
− | <h4 class="mdl-card__title-text" style="font-size: 250%">Background & Design</h4> | + | <h4 class="mdl-card__title-text" style="font-size: 250%; color:#5a5a5a">Background & Design</h4> |
</div> | </div> | ||
<div class="mdl-card__supporting-text" style="font-size: 115%"> | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
Line 208: | Line 210: | ||
</div> | </div> | ||
<!-- Description --> | <!-- Description --> | ||
− | <div class="demo-card-wide mdl-card mdl-shadow--2dp"> | + | <div class="demo-card-wide mdl-card mdl-shadow--2dp" style="border-radius:10px"> |
<div class="mdl-card__title"> | <div class="mdl-card__title"> | ||
− | <h4 class="mdl-card__title-text" style="font-size: 250%">Description</h4> | + | <h4 class="mdl-card__title-text" style="font-size: 250%; color:#5a5a5a">Description</h4> |
</div> | </div> | ||
<div class="mdl-card__supporting-text" style="font-size: 115%"> | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
Line 221: | Line 223: | ||
</div> | </div> | ||
<!-- Result --> | <!-- Result --> | ||
− | <div class="demo-card-wide mdl-card mdl-shadow--2dp"> | + | <div class="demo-card-wide mdl-card mdl-shadow--2dp" style="border-radius:10px"> |
<div class="mdl-card__title"> | <div class="mdl-card__title"> | ||
− | <h4 class="mdl-card__title-text" style="font-size: 250%">Results</h4> | + | <h4 class="mdl-card__title-text" style="font-size: 250%; color:#5a5a5a">Results</h4> |
</div> | </div> | ||
− | |||
<div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
Sequencing | Sequencing | ||
Line 294: | Line 295: | ||
</table> | </table> | ||
</div> | </div> | ||
− | |||
<div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
Table 1 - OD600 Reference Point | Table 1 - OD600 Reference Point | ||
Line 350: | Line 350: | ||
</table> | </table> | ||
</div> | </div> | ||
− | |||
<div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
Table 2 - FITC Standard Curve | Table 2 - FITC Standard Curve | ||
Line 649: | Line 648: | ||
</div> | </div> | ||
− | |||
<div class="android-drawer-separator"></div> | <div class="android-drawer-separator"></div> | ||
</div> | </div> | ||
<!-- Methods and Materials --> | <!-- Methods and Materials --> | ||
− | <div class="demo-card-wide mdl-card mdl-shadow--2dp"> | + | <div class="demo-card-wide mdl-card mdl-shadow--2dp" style="border-radius:10px"> |
<div class="mdl-card__title"> | <div class="mdl-card__title"> | ||
− | <h4 class="mdl-card__title-text" style="font-size: 250%">Methods & Materials</h4> | + | <h4 class="mdl-card__title-text" style="font-size: 250%; color:#5a5a5a">Methods & Materials</h4> |
</div> | </div> | ||
− | <div class="mdl-card__supporting-text" style="font-size: 115%"> | + | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> |
Strain used: E. coli DH5-alpha | Strain used: E. coli DH5-alpha | ||
</div> | </div> | ||
− | <div class="mdl-card__supporting-text" style="font-size: 115%"> | + | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> |
Plasmid DNA (100 pg/uL in 10uL of water) | Plasmid DNA (100 pg/uL in 10uL of water) | ||
− | <div class="mdl-card__supporting-text" style="font-size: 75%; white-space: pre-line | + | <div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto; padding-top:0px; white-space: pre-line"> |
Positive Control (BBa_I20270): J23151.B0032.E0040.B0010.B0012 in pSB1C3 | Positive Control (BBa_I20270): J23151.B0032.E0040.B0010.B0012 in pSB1C3 | ||
Negative Control (BBa_R0040): R0040 in pSB1C3 | Negative Control (BBa_R0040): R0040 in pSB1C3 | ||
Line 673: | Line 671: | ||
</div> | </div> | ||
</div> | </div> | ||
− | <div class="mdl-card__supporting-text" style="font-size: 115%"> | + | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> |
Materials | Materials | ||
− | <div class="mdl-card__supporting-text" style="font-size: 75%; white-space: pre-line;"> | + | <div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto; padding-top:0px; white-space: pre-line;"> |
FITC Standard: one tube with dried down FITC for creating a FITC standard | FITC Standard: one tube with dried down FITC for creating a FITC standard | ||
LUDOX: one tube with 30% colloidal silica suspended in 1mL of water | LUDOX: one tube with 30% colloidal silica suspended in 1mL of water | ||
Line 688: | Line 686: | ||
</div> | </div> | ||
</div> | </div> | ||
− | <div class="mdl-card__supporting-text" style="font-size: | + | <div class="mdl-card__supporting-text" style="font-size: 90%; text-align:center; white-space: pre-line;"> |
Machines: SpectraMax M5, SPX-150B-Z biochemical incubator and THZ-312 Thermostatic oscillator | Machines: SpectraMax M5, SPX-150B-Z biochemical incubator and THZ-312 Thermostatic oscillator | ||
Software: Microsoft Excel and pro5 | Software: Microsoft Excel and pro5 | ||
Line 707: | Line 705: | ||
<div class="mdl-typography--display-2 mdl-typography--font-thin">Our team worked on </div> | <div class="mdl-typography--display-2 mdl-typography--font-thin">Our team worked on </div> | ||
<p class="mdl-typography--headline mdl-typography--font-thin"> | <p class="mdl-typography--headline mdl-typography--font-thin"> | ||
− | + | something | |
</p> | </p> | ||
<p> | <p> |
Revision as of 23:16, 17 October 2017
Background & Design
Description
Results
Length | Sequence | |
---|---|---|
BBa_R0040 Part-only sequence | 54 bp | tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac |
BBa_J23101 Part-only sequence | 35 bp | tttacagctagctcagtcctaggtattatgctagc |
BBa_J23106 Part-only sequence | 35 bp | ttacggctagctcagtcctaggtatagtgctagc |
BBa_J23117 Part-only sequence | 35 bp | ttgacagctagctcagtcctagggattgtgctagc |
BBa_J364100 Part-only sequence | 84 bp | gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttct |
BBa_B0010 Part-only sequence | 80 bp | ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc |
BBa_B0012 Part-only sequence | 41 bp | tcacactggctcaccttcgggtgggcctttctgcgtttata |
BBa_E0040 Part-only sequence | 720 bp | atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtg atgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaa acttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtc actactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatg actttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaaga tgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaataga atcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaat acaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagt taacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaa caaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacac aatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgt aacagctgctgggattacacatggcatggatgaactatacaaataataa |
LUDOX-HS40 | H2O | |
---|---|---|
Replicate 1 | 0.00624 | -0.00726 |
Replicate 2 | 0.00684 | -0.00526 |
Replicate 3 | 0.00734 | -0.00366 |
Replicate 4 | 0.01104 | -0.00476 |
Arithmetic Mean | 0.007865 | -0.00524 |
Corrected Abs600 | 0.0131 | |
Reference OD600 | 0.0425 | |
OD600/Abs600 | 3.244275 |
uM Fluorescein | Replicate 1 | Replicate 2 | Replicate 3 | Replicate 4 | Arith. Mean | Arith. Std.Dev. |
---|---|---|---|---|---|---|
50 |
61138.13773 |
65271.06373 |
64591.86073 |
65095.54373 |
64024.15148 |
1945.425461 |
25 |
46595.20773 |
47958.14973 |
47759.33273 |
46973.06773 |
47321.43948 |
644.4444304 |
12.5 |
28000.11673 |
29885.96173 |
29220.19473 |
29151.63573 |
29064.47723 |
783.0590871 |
6.25 |
15683.49573 |
16760.13373 |
16218.20373 |
16178.31273 |
16210.03648 |
440.0474392 |
3.125 |
8520.498733 |
8943.591733 |
8732.387733 |
8904.756733 |
8775.308733 |
193.0857332 |
1.5625 |
3763.249733 |
4130.652733 |
3895.511733 |
4038.104733 |
3956.879733 |
161.3000976 |
0.78125 |
1812.487733 |
2054.542733 |
1959.396733 |
2020.259733 |
1961.671733 |
106.9557819 |
0.390625 |
985.464733 |
1054.489733 |
1024.705733 |
1069.755733 |
1033.603983 |
37.14713908 |
0.1953125 |
497.078733 |
527.161733 |
514.866733 |
522.469733 |
515.394233 |
13.21958841 |
0.09765625 |
244.808733 |
261.900733 |
248.052733 |
257.166733 |
252.982233 |
7.919506613 |
0.048828125 |
119.568733 |
122.370733 |
123.219733 |
127.955733 |
123.278733 |
3.48646784 |
0 |
0.419733 |
0.411733 |
0.046733 |
0.241733 |
0.279983 |
0.175837757 |
Methods & Materials
Like our fantastic advisors, some other people and maybe even a couple of companies!
Find out about our team and our friends