Difference between revisions of "Team:Tongji China/InterLab"

Revision as of 15:49, 18 October 2017

Tongji iGEM

InterLab

We partecipated in the 4^th iGEM Interlab study along with about 100 teams. We have focused on quantifying the expression of GFP in common, comparable or absolute units.

Background & Design

Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in different units. In our case, we measured fluorescence using a plate reader.

It is very common to use fluorescence as a proxy for promoter activity, and the green fluorescent protein (GFP) is the most popular protein. Although detecting the intensity of fluorescence is an indirect measurement, we can use it as representative of the expression levels of GFP. This method has a significant advantage, which is that it allows to monitor continuously without disrupting cells.

Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.

We aim to proceed in the experiment using the supplied FITC as a standard reference material. The standard curve can be constructed by measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform a relative measurements of fluorescence into an absolute measurements of GFP.

However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.

Description

Plasmids containing promoters and GFP were taken from The 2017 DNA Distribution Kit 7 and all devices were transformed into E. coli.

3ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.

Results

Sequencing

	Length	Sequence
BBa_R0040 Part-only sequence	54 bp	tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac
BBa_J23101 Part-only sequence	35 bp	tttacagctagctcagtcctaggtattatgctagc
BBa_J23106 Part-only sequence	35 bp	ttacggctagctcagtcctaggtatagtgctagc
BBa_J23117 Part-only sequence	35 bp	ttgacagctagctcagtcctagggattgtgctagc
BBa_J364100 Part-only sequence	84 bp	gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttct
BBa_B0010 Part-only sequence	80 bp	ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc
BBa_B0012 Part-only sequence	41 bp	tcacactggctcaccttcgggtgggcctttctgcgtttata
BBa_E0040 Part-only sequence	720 bp	atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtg atgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaa acttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtc actactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatg actttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaaga tgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaataga atcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaat acaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagt taacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaa caaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacac aatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgt aacagctgctgggattacacatggcatggatgaactatacaaataataa

Table 1 - OD600 Reference Point

	LUDOX-HS40	H2O
Replicate 1	0.00624	-0.00726
Replicate 2	0.00684	-0.00526
Replicate 3	0.00734	-0.00366
Replicate 4	0.01104	-0.00476
Arithmetic Mean	0.007865	-0.00524
Corrected Abs600	0.0131
Reference OD600	0.0425
OD600/Abs600	3.244275

Table 2 - FITC Standard Curve

uM Fluorescein	Replicate 1	Replicate 2	Replicate 3	Replicate 4	Arith. Mean	Arith. Std.Dev.
50	61138.13773	65271.06373	64591.86073	65095.54373	64024.15148	1945.425461
25	46595.20773	47958.14973	47759.33273	46973.06773	47321.43948	644.4444304
12.5	28000.11673	29885.96173	29220.19473	29151.63573	29064.47723	783.0590871
6.25	15683.49573	16760.13373	16218.20373	16178.31273	16210.03648	440.0474392
3.125	8520.498733	8943.591733	8732.387733	8904.756733	8775.308733	193.0857332
1.5625	3763.249733	4130.652733	3895.511733	4038.104733	3956.879733	161.3000976
0.78125	1812.487733	2054.542733	1959.396733	2020.259733	1961.671733	106.9557819
0.390625	985.464733	1054.489733	1024.705733	1069.755733	1033.603983	37.14713908
0.1953125	497.078733	527.161733	514.866733	522.469733	515.394233	13.21958841
0.09765625	244.808733	261.900733	248.052733	257.166733	252.982233	7.919506613
0.048828125	119.568733	122.370733	123.219733	127.955733	123.278733	3.48646784
0	0.419733	0.411733	0.046733	0.241733	0.279983	0.175837757

Methods & Materials

Strain used: E. coli DH5-alpha

Plasmid DNA (100 pg/uL in 10uL of water)

Positive Control (BBa_I20270): J23151.B0032.E0040.B0010.B0012 in pSB1C3 Negative Control (BBa_R0040): R0040 in pSB1C3 Test Device 1 (BBa_J364000): J23101.B0034.E0040.B0010.B0012 in pSB1C3 Test Device 2 (BBa_J364001): J23106.B0034.E0040.B0010.B0012 in pSB1C3 Test Device 3 (BBa_J364002): J23117.B0034.E0040.B0010.B0012 in pSB1C3 Test Device 4 (BBa_J364003): J23101.J364100.E0040.B0010.B0012 in pSB1C3 Test Device 5 (BBa_J364004): J23106.J364100.E0040.B0010.B0012 in pSB1C3 Test Device 6 (BBa_J364005): J23117.J364100.E0040.B0010.B0012 in pSB1C3

Materials

FITC Standard: one tube with dried down FITC for creating a FITC standard LUDOX: one tube with 30% colloidal silica suspended in 1mL of water 1xPBS (phosphate buffered saline) LB (Luria Bertani) media Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH) 50 ml Falcon tube (or equivalent) or 250 ml shake flask for cell growth 1.5 ml eppendorf tubes for sample storage Ice bucket with ice Pipettes Black 96 well plate

Machines: SpectraMax M5, SPX-150B-Z biochemical incubator and THZ-312 Thermostatic oscillator Software: Microsoft Excel and pro5 Calibration: OD600 Reference point and FITC fluorescence standard curve Cell measurement: Transformation and Measurements

Our team worked on

something

See how we did it

We would like to thanks those who helped us

Like our fantastic advisors, some other people and maybe even a couple of companies!
Find out about our team and our friends

Here are the most important links

Some kind of page 1

Description of the page 1

Call to action 1

Some kind of page 2

Description of the page 2

Call to action 2

Some kind of page 3

Description of the page 3

Call to action 3

Some kind of page 4

Description of the page 4

Call to action 3

@@ Line 32: / Line 32: @@
      <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Template:Tongji_China/CSS_2?action=raw&ctype=text/css">
      <link rel="stylesheet" type="text/css" href="https://2017.igem.org/Template:Tongji_China/CSS_3?action=raw&ctype=text/css">
-    <style>
+    <style>
      .demo-card-wide.mdl-card {
        margin: auto;
@@ Line 57: / Line 57: @@
        }
    	}
+    </style>
      <script type="text/javascript">
      // Try to remove weird iGEM side menu and resize the remaining things
-    // var menuToRemove = document.getElementById('sideMenu').style.display = "none";
      function closeMenuDiv(){
        document.getElementById("sideMenu").style.display = "none";
        bars_box_active = false;
        document.getElementById('content').setAttribute("style","display:block;width:100%");
        document.getElementById('content').style.width='100%';
@@ Line 75: / Line 72: @@
      window.setTimeout(closeMenuDiv,1000);
      window.setTimeout(closeMenuDiv,10000);
      </script>
-    </style>
-    <script type="text/javascript">
-    // Try to remove weird iGEM side menu
-    // var menuToRemove = document.getElementById('sideMenu').style.display = "none";
-    function closeMenuDiv(){
-      document.getElementById("sideMenu").style.display = "none";
-      bars_box_active = false;
-    }
-    window.setTimeout(closeMenuDiv,50);
-    window.setTimeout(closeMenuDiv,100);
-    window.setTimeout(closeMenuDiv,200);
-    window.setTimeout(closeMenuDiv,1000);
-    window.setTimeout(closeMenuDiv,10000);
-    </script>
    </head>
    <body>
      <div class="mdl-layout mdl-js-layout mdl-layout--fixed-header" class="main view" style="background:#f9f9f9">
+      <!-- Header -->
        <div class="android-header mdl-layout__header mdl-layout__header--waterfall">
          <div class="mdl-layout__header-row">
            <span class="android-title mdl-layout-title">
              <div class="logo-font">TongJi iGEM</div>
-            <!-- <img class="android-logo-image" src="2017tongji_images/android-logo.png"> -->
            </span>
            <!-- Add spacer, to align navigation to the right in desktop -->
            <div class="android-header-spacer mdl-layout-spacer"></div>
-          <!-- <div class="android-search-box mdl-textfield mdl-js-textfield mdl-textfield--expandable mdl-textfield--floating-label mdl-textfield--align-right mdl-textfield--full-width">
-            <label class="mdl-button mdl-js-button mdl-button--icon" for="search-field">
-              <i class="material-icons">search</i>
-            </label>
-            <div class="mdl-textfield__expandable-holder">
-              <input class="mdl-textfield__input" type="text" id="search-field">
-            </div>
-          </div> -->
            <!-- Navigation -->
            <div class="android-navigation-container">
              <nav class="android-navigation mdl-navigation">
+              <!-- Links in the top right -->
                <a class="mdl-navigation__link mdl-typography--text-uppercase" href="https://2017.igem.org/Team:Tongji_China">Home</a>
                <a class="mdl-navigation__link mdl-typography--text-uppercase" href="https://2017.igem.org/Team:Tongji_China/Description">Project</a>
                <a class="mdl-navigation__link mdl-typography--text-uppercase" href="https://2017.igem.org/Team:Tongji_China/Team">Team</a>
                <a class="mdl-navigation__link mdl-typography--text-uppercase" href="https://2017.igem.org/Team:Tongji_China/Results">Results</a>
-              <!-- <a class="mdl-navigation__link mdl-typography--text-uppercase" href="">Auto</a>
-              <a class="mdl-navigation__link mdl-typography--text-uppercase" href="">One</a>
-              <a class="mdl-navigation__link mdl-typography--text-uppercase" href="">Play</a> -->
              </nav>
            </div>
            <span class="android-mobile-title mdl-layout-title">
              <div class="logo-font">TongJi iGEM</div>
-            <!-- <img class="android-logo-image" src="2017tongji_images/android-logo.png"> -->
            </span>
-          <!-- <button class="android-more-button mdl-button mdl-js-button mdl-button--icon mdl-js-ripple-effect" id="more-button">
-            <i class="material-icons">more_vert</i>
-          </button>
-          <ul class="mdl-menu mdl-js-menu mdl-menu--bottom-right mdl-js-ripple-effect" for="more-button">
-            <li disabled class="mdl-menu__item">Design</li>
-            <li disabled class="mdl-menu__item">Experiments</li>
-            <li disabled class="mdl-menu__item">Notebook</li>
-            <li disabled class="mdl-menu__item">Parts</li>
-          </ul> -->
          </div>
        </div>
+      <!-- Drawer -->
        <div class="android-drawer mdl-layout__drawer">
-        <!-- <span class="mdl-layout-title" style="color:#ffffff; background: #EFEFEF;">
-          <img class="android-logo-image" style="height: 96px; left: 50px;" src="2017tongji_images/2017tongji_logo1.png">
-        </span> -->
          <nav class="mdl-navigation">
            <!-- <span class="mdl-navigation__link" href="">Title</span> -->
@@ Line 177: / Line 132: @@
        <div class="android-content mdl-layout__content">
          <a name="top"></a>
+        <!-- Title and Subtitle -->
          <div class="mdl-typography--text-center" style="margin-bottom:20%">
            <div class="logo-font android-slogan" style="color:#388E3C;">InterLab</div>
            <div class="logo-font android-sub-slogan" style="color:#757575;">We partecipated in the 4<sup>th</sup> iGEM Interlab study along with about 100 teams. We have focused on quantifying the expression of GFP in common, comparable or absolute units.</div>
-          <!-- <a href="#InterLab">
-            <button class="android-fab mdl-button mdl-button--colored mdl-js-button mdl-button--fab mdl-js-ripple-effect">
-              <i class="material-icons">expand_more</i>
-            </button>
-          </a> -->
          </div>
          <!-- Background and Design -->
          <div class="demo-card-wide mdl-card mdl-shadow--2dp" style="border-radius:10px">
@@ Line 209: / Line 160: @@
            <div class="android-drawer-separator"></div>
          </div>
          <!-- Description -->
          <div class="demo-card-wide mdl-card mdl-shadow--2dp" style="border-radius:10px">
@@ Line 222: / Line 174: @@
            <div class="android-drawer-separator"></div>
          </div>
          <!-- Result -->
          <div class="demo-card-wide mdl-card mdl-shadow--2dp" style="border-radius:10px">
@@ Line 644: / Line 597: @@
              	</tbody>
              </table>
            </div>
            <div class="android-drawer-separator"></div>
          </div>
          <!-- Methods and Materials -->
          <div class="demo-card-wide mdl-card mdl-shadow--2dp" style="border-radius:10px">
@@ Line 694: / Line 645: @@
            <div class="android-drawer-separator"></div>
          </div>
          <div class="android-wear-section">
@@ Line 715: / Line 661: @@
            </div>
          </div>
          <div class="android-customized-section">
            <div class="android-customized-section-text">
@@ Line 726: / Line 673: @@
            <div class="android-customized-section-image"></div>
          </div>
          <div class="android-more-section">
            <div class="android-section-title mdl-typography--display-1-color-contrast">Here are the most important links</div>