Line 24: | Line 24: | ||
<meta name="description" content="2017 Tongji iGEM team wiki"> | <meta name="description" content="2017 Tongji iGEM team wiki"> | ||
<meta name="viewport" content="width=device-width, initial-scale=1.0, minimum-scale=1.0"> | <meta name="viewport" content="width=device-width, initial-scale=1.0, minimum-scale=1.0"> | ||
− | <title>Tongji iGEM</title> | + | <title>Tongji iGEM - InterLab</title> |
<script src="https://2017.igem.org/Template:Tongji_China/Javascript?action=raw&ctype=text/javascript"></script> | <script src="https://2017.igem.org/Template:Tongji_China/Javascript?action=raw&ctype=text/javascript"></script> | ||
Line 155: | Line 155: | ||
</div> | </div> | ||
<div class="mdl-card__supporting-text" style="font-size: 115%"> | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
− | Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in different units. In our case, we measured fluorescence using a plate reader. | + | <br>Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in different units. In our case, we measured fluorescence using a plate reader.</br> |
− | + | <br>It is very common to use fluorescence as a proxy for promoter activity, and the green fluorescent protein (GFP) is the most popular protein. Although detecting the intensity of fluorescence is an indirect measurement, we can use it as representative of the expression levels of GFP. This method has a significant advantage, which is that it allows to monitor continuously without disrupting cells.</br> | |
− | + | <br>Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.</br> | |
− | + | <br>We aim to proceed in the experiment using the supplied FITC as a standard reference material. The standard curve can be constructed by measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform a relative measurements of fluorescence into an absolute measurements of GFP.</br> | |
− | + | <br>However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.</br> | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
</div> | </div> | ||
<div class="android-drawer-separator"></div> | <div class="android-drawer-separator"></div> | ||
Line 178: | Line 170: | ||
</div> | </div> | ||
<div class="mdl-card__supporting-text" style="font-size: 115%"> | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
− | Plasmids containing promoters and GFP were taken from The 2017 DNA Distribution Kit 7 and all devices were transformed into E. coli. | + | <br>Plasmids containing promoters and GFP were taken from The 2017 DNA Distribution Kit 7 and all devices were transformed into E. coli.</br> |
− | + | <br>3ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.</br> | |
− | + | ||
− | + | ||
</div> | </div> | ||
<div class="android-drawer-separator"></div> | <div class="android-drawer-separator"></div> | ||
Line 1,562: | Line 1,552: | ||
</div> | </div> | ||
<div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
− | Strain used: E. coli DH5-alpha | + | <br>Strain used: E. coli DH5-alpha</br> |
− | + | <br>Plasmid DNA (100 pg/uL in 10uL of water)</br> | |
− | + | ||
− | + | ||
<div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto; white-space: pre-line">Positive Control (BBa_I20270): J23151.B0032.E0040.B0010.B0012 in pSB1C3 | <div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto; white-space: pre-line">Positive Control (BBa_I20270): J23151.B0032.E0040.B0010.B0012 in pSB1C3 | ||
Negative Control (BBa_R0040): R0040 in pSB1C3 | Negative Control (BBa_R0040): R0040 in pSB1C3 | ||
Line 1,575: | Line 1,563: | ||
Test Device 6 (BBa_J364005): J23117.J364100.E0040.B0010.B0012 in pSB1C3 | Test Device 6 (BBa_J364005): J23117.J364100.E0040.B0010.B0012 in pSB1C3 | ||
</div> | </div> | ||
− | + | <br>Materials</br> | |
− | + | ||
− | + | ||
<div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto; white-space: pre-line;">FITC Standard: one tube with dried down FITC for creating a FITC standard | <div class="mdl-card__supporting-text" style="font-size: 75%; margin:auto; white-space: pre-line;">FITC Standard: one tube with dried down FITC for creating a FITC standard | ||
LUDOX: one tube with 30% colloidal silica suspended in 1mL of water | LUDOX: one tube with 30% colloidal silica suspended in 1mL of water | ||
Line 1,601: | Line 1,587: | ||
</div> | </div> | ||
+ | <!-- HERE ENDS THE PAGE --> | ||
+ | <!-- Go back Home --> | ||
<div class="android-wear-section" style="height:250px"> | <div class="android-wear-section" style="height:250px"> | ||
<div class="android-wear-band"> | <div class="android-wear-band"> | ||
<div class="android-wear-band-text"> | <div class="android-wear-band-text"> | ||
<div class="mdl-typography--display-2 mdl-typography--font-thin">That's it!</div> | <div class="mdl-typography--display-2 mdl-typography--font-thin">That's it!</div> | ||
− | <p class="mdl-typography--headline mdl-typography--font-thin"> | + | <p class="mdl-typography--headline mdl-typography--font-thin" style="margin-bottom:0px"> |
This page has sadly ended, if you want you can go back | This page has sadly ended, if you want you can go back | ||
</p> | </p> | ||
Line 1,629: | Line 1,617: | ||
</div> --> | </div> --> | ||
+ | <!-- Quick links --> | ||
<div class="android-more-section"> | <div class="android-more-section"> | ||
<div class="android-section-title mdl-typography--display-1-color-contrast">Or follow these links for more awesomeness!</div> | <div class="android-section-title mdl-typography--display-1-color-contrast">Or follow these links for more awesomeness!</div> | ||
Line 1,724: | Line 1,713: | ||
<div class="mdl-mega-footer--middle-section"> | <div class="mdl-mega-footer--middle-section"> | ||
− | <p class="mdl-typography--font-light">This page was adapted from a template from getmdl.io</p> | + | <p class="mdl-typography--font-light" style="align-self:right">This page was adapted from a template from getmdl.io</p> |
</div> | </div> | ||
Revision as of 20:04, 21 October 2017
TongJi iGEM
TongJi iGEM
InterLab
We partecipated in the 4th iGEM Interlab study along with about 100 teams. We have focused on quantifying the expression of GFP in common, comparable or absolute units.
Background & Design
Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in different units. In our case, we measured fluorescence using a plate reader.
It is very common to use fluorescence as a proxy for promoter activity, and the green fluorescent protein (GFP) is the most popular protein. Although detecting the intensity of fluorescence is an indirect measurement, we can use it as representative of the expression levels of GFP. This method has a significant advantage, which is that it allows to monitor continuously without disrupting cells.
Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.
We aim to proceed in the experiment using the supplied FITC as a standard reference material. The standard curve can be constructed by measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform a relative measurements of fluorescence into an absolute measurements of GFP.
However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.
Description
Plasmids containing promoters and GFP were taken from The 2017 DNA Distribution Kit 7 and all devices were transformed into E. coli.
3ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.
Results
Sequencing
Length | Sequence | |
---|---|---|
BBa_R0040 Part-only sequence | 54 bp | tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac |
BBa_J23101 Part-only sequence | 35 bp | tttacagctagctcagtcctaggtattatgctagc |
BBa_J23106 Part-only sequence | 35 bp | ttacggctagctcagtcctaggtatagtgctagc |
BBa_J23117 Part-only sequence | 35 bp | ttgacagctagctcagtcctagggattgtgctagc |
BBa_J364100 Part-only sequence | 84 bp | gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttct |
BBa_B0010 Part-only sequence | 80 bp | ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc |
BBa_B0012 Part-only sequence | 41 bp | tcacactggctcaccttcgggtgggcctttctgcgtttata |
BBa_E0040 Part-only sequence | 720 bp | atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtg atgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaa acttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtc actactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatg actttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaaga tgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaataga atcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaat acaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagt taacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaa caaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacac aatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgt aacagctgctgggattacacatggcatggatgaactatacaaataataa |
Table 1 - OD600 Reference Point
LUDOX-HS40 | H2O | |
---|---|---|
Replicate 1 | 0.00624 | -0.00726 |
Replicate 2 | 0.00684 | -0.00526 |
Replicate 3 | 0.00734 | -0.00366 |
Replicate 4 | 0.01104 | -0.00476 |
Arithmetic Mean | 0.007865 | -0.00524 |
Corrected Abs600 | 0.0131 | |
Reference OD600 | 0.0425 | |
OD600/Abs600 | 3.244275 |
Table 2 - FITC Standard Curve
uM Fluorescein | Replicate 1 | Replicate 2 | Replicate 3 | Replicate 4 | Arith. Mean | Arith. Std.Dev. |
---|---|---|---|---|---|---|
50 | 61138.13773 | 65271.06373 | 64591.86073 | 65095.54373 | 64024.15148 | 1945.425461 |
25 | 46595.20773 | 47958.14973 | 47759.33273 | 46973.06773 | 47321.43948 | 644.4444304 |
12.5 | 28000.11673 | 29885.96173 | 29220.19473 | 29151.63573 | 29064.47723 | 783.0590871 |
6.25 | 15683.49573 | 16760.13373 | 16218.20373 | 16178.31273 | 16210.03648 | 440.0474392 |
3.125 | 8520.498733 | 8943.591733 | 8732.387733 | 8904.756733 | 8775.308733 | 193.0857332 |
1.5625 | 3763.249733 | 4130.652733 | 3895.511733 | 4038.104733 | 3956.879733 | 161.3000976 |
0.78125 | 1812.487733 | 2054.542733 | 1959.396733 | 2020.259733 | 1961.671733 | 106.9557819 |
0.390625 | 985.464733 | 1054.489733 | 1024.705733 | 1069.755733 | 1033.603983 | 37.14713908 |
0.1953125 | 497.078733 | 527.161733 | 514.866733 | 522.469733 | 515.394233 | 13.21958841 |
0.09765625 | 244.808733 | 261.900733 | 248.052733 | 257.166733 | 252.982233 | 7.919506613 |
0.048828125 | 119.568733 | 122.370733 | 123.219733 | 127.955733 | 123.278733 | 3.48646784 |
0 | 0.419733 | 0.411733 | 0.046733 | 0.241733 | 0.279983 | 0.175837757 |
Table 3 - Raw data of Abs600 measurement
0 | 2 | 4 | 6 | ||
---|---|---|---|---|---|
Negative Control | CLONE 1 | 0.0295 | 0.130507 | 0.314472 | 0.42238 |
CLONE 2 | 0.031975 | 0.135382 | 0.354122 | 0.43548 | |
Positive Control | CLONE 1 | 0.0305 | 0.161232 | 0.351597 | 0.488955 |
CLONE 2 | 0.02885 | 0.162257 | 0.417697 | 0.50018 | |
Test Device 1 | CLONE 1 | 0.028375 | 0.057732 | 0.148547 | 0.269505 |
CLONE 2 | 0.02985 | 0.048457 | 0.112622 | 0.20678 | |
Test Device 2 | CLONE 1 | 0.0314 | 0.148682 | 0.394347 | 0.46823 |
CLONE 2 | 0.029025 | 0.125007 | 0.375497 | 0.43273 | |
Test Device 3 | CLONE 1 | 0.030775 | 0.167307 | 0.400422 | 0.456205 |
CLONE 2 | 0.027175 | 0.156457 | 0.405647 | 0.483105 | |
Test Device 4 | CLONE 1 | 0.0305 | 0.158857 | 0.398722 | 0.45088 |
CLONE 2 | 0.03015 | 0.155507 | 0.401822 | 0.453755 | |
Test Device 5 | CLONE 1 | 0.0362 | 0.163682 | 0.410647 | 0.472155 |
CLONE 2 | 0.03205 | 0.142507 | 0.377622 | 0.436505 | |
Test Device 6 | CLONE 1 | 0.03545 | 0.176682 | 0.385822 | 0.45088 |
CLONE 2 | 0.02795 | 0.153382 | 0.402072 | 0.449205 |
Table 4 - Raw data of fluorescence measurement
0 | 2 | 4 | 6 | ||
---|---|---|---|---|---|
Negative Control | CLONE 1 | 1.08025 | 2.16875 | 16.13602 | 29.83945 |
CLONE 2 | 1.96175 | 1.974 | 19.02202 | 32.08245 | |
Positive Control | CLONE 1 | 13.218 | 157.839 | 413.9833 | 493.0602 |
CLONE 2 | 19.26725 | 178.7663 | 485.3383 | 578.5027 | |
Test Device 1 | CLONE 1 | 203.4893 | 515.1385 | 1366.608 | 2527.968 |
CLONE 2 | 216.369 | 550.578 | 1161.084 | 2002.293 | |
Test Device 2 | CLONE 1 | 52.94075 | 330.942 | 1212.613 | 1625.767 |
CLONE 2 | 57.626 | 300.5665 | 1104.674 | 1431.868 | |
Test Device 3 | CLONE 1 | 2.81475 | 4.924 | 32.52677 | 47.32195 |
CLONE 2 | 3.3015 | 4.3785 | 31.76152 | 56.2147 | |
Test Device 4 | CLONE 1 | 2.65525 | 6.173 | 34.00727 | 45.5552 |
CLONE 2 | 2.00575 | 5.008 | 37.20552 | 51.47795 | |
Test Device 5 | CLONE 1 | 19.70225 | 167.6278 | 435.9625 | 529.8542 |
CLONE 2 | 17.1425 | 140.0155 | 430.8645 | 498.9205 | |
Test Device 6 | CLONE 1 | 3.124 | 5.37275 | 19.22877 | 30.8587 |
CLONE 2 | 1.186134 | 5.4735 | 27.23052 | 39.53995 |
Table 5 - Raw data of Fl/Abs600
0H | 2H | 4H | 6H | ||
---|---|---|---|---|---|
Negative Control | Colony 1 | 0.0049 | 0.0021 | 0.0066 | 0.0091 |
Colony 2 | 0.0080 | 0.0019 | 0.0070 | 0.0095 | |
Positive Control | Colony 1 | 0.0559 | 0.1265 | 0.1525 | 0.1303 |
Colony 2 | 0.0866 | 0.1422 | 0.1501 | 0.1493 | |
Test Device 1 | Colony 1 | 0.9270 | 1.1547 | 1.1894 | 1.2126 |
Colony 2 | 0.9366 | 1.4767 | 1.3349 | 1.2506 | |
Test Device 2 | Colony 1 | 0.2177 | 0.2875 | 0.3997 | 0.4487 |
Colony 2 | 0.2583 | 0.3105 | 0.3807 | 0.4273 | |
Test Device 3 | Colony 1 | 0.0118 | 0.0038 | 0.0104 | 0.0133 |
Colony 2 | 0.0166 | 0.0036 | 0.0102 | 0.0150 | |
Test Device 4 | Colony 1 | 0.0114 | 0.0050 | 0.0109 | 0.0130 |
Colony 2 | 0.0089 | 0.0042 | 0.0120 | 0.0146 | |
Test Device 5 | Colony 1 | 0.0710 | 0.1324 | 0.1375 | 0.1449 |
Colony 2 | 0.0685 | 0.1269 | 0.1476 | 0.1476 | |
Test Device 6 | Colony 1 | 0.0113 | 0.0039 | 0.0064 | 0.0088 |
Colony 2 | 0.0055 | 0.0046 | 0.0087 | 0.0114 |
Conclusions
It is noticeable that the promoter of the Device 1 is the strongest followed by the promoters of the devices 2 and 5. But the device 3, 4 and 6 are not active.
Methods & Materials
Strain used: E. coli DH5-alpha
Plasmid DNA (100 pg/uL in 10uL of water)
Positive Control (BBa_I20270): J23151.B0032.E0040.B0010.B0012 in pSB1C3
Negative Control (BBa_R0040): R0040 in pSB1C3
Test Device 1 (BBa_J364000): J23101.B0034.E0040.B0010.B0012 in pSB1C3
Test Device 2 (BBa_J364001): J23106.B0034.E0040.B0010.B0012 in pSB1C3
Test Device 3 (BBa_J364002): J23117.B0034.E0040.B0010.B0012 in pSB1C3
Test Device 4 (BBa_J364003): J23101.J364100.E0040.B0010.B0012 in pSB1C3
Test Device 5 (BBa_J364004): J23106.J364100.E0040.B0010.B0012 in pSB1C3
Test Device 6 (BBa_J364005): J23117.J364100.E0040.B0010.B0012 in pSB1C3
Materials
FITC Standard: one tube with dried down FITC for creating a FITC standard
LUDOX: one tube with 30% colloidal silica suspended in 1mL of water
1xPBS (phosphate buffered saline)
LB (Luria Bertani) media
Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH)
50 ml Falcon tube (or equivalent) or 250 ml shake flask for cell growth
1.5 ml eppendorf tubes for sample storage
Ice bucket with ice
Pipettes
Black 96 well plate
Machines: SpectraMax M5, SPX-150B-Z biochemical incubator and THZ-312 Thermostatic oscillator
Software: Microsoft Excel and pro5
Calibration: OD600 Reference point and FITC fluorescence standard curve
Cell measurement: Transformation and Measurements
Protocol for calibration and measurement
Raw Data
Or follow these links for more awesomeness!