Line 20: | Line 20: | ||
<html lang="en"> | <html lang="en"> | ||
<head> | <head> | ||
+ | <meta charset="utf-8"> | ||
+ | <meta http-equiv="X-UA-Compatible" content="IE=edge"> | ||
+ | <meta name="description" content="2017 Tongji iGEM team wiki"> | ||
+ | <meta name="viewport" content="width=device-width, initial-scale=1.0, minimum-scale=1.0"> | ||
<title>Tongji iGEM</title> | <title>Tongji iGEM</title> | ||
Line 57: | Line 61: | ||
box-shadow: 0 0 20px rgba(0, 0, 0, 1); | box-shadow: 0 0 20px rgba(0, 0, 0, 1); | ||
transition: 0.3s cubic-bezier(0.2, 1, 0.2, 1); | transition: 0.3s cubic-bezier(0.2, 1, 0.2, 1); | ||
+ | } | ||
+ | |||
+ | .demo-card-wide.mdl-card { | ||
+ | margin: auto; | ||
+ | margin-top: 20px; | ||
+ | align-items: center; | ||
+ | width: 80%; | ||
+ | } | ||
+ | .demo-card-wide > .mdl-card__title { | ||
+ | color: #757575; | ||
+ | align-self: center; | ||
+ | /*height: 176px;*/ | ||
+ | } | ||
+ | .demo-card-wide > .mdl-card__menu { | ||
+ | color: #757575; | ||
} | } | ||
Line 96: | Line 115: | ||
<div class="android-navigation-container"> | <div class="android-navigation-container"> | ||
<nav class="android-navigation mdl-navigation"> | <nav class="android-navigation mdl-navigation"> | ||
− | <a class="mdl-navigation__link mdl-typography--text-uppercase" href=" | + | <a class="mdl-navigation__link mdl-typography--text-uppercase" href="https://2017.igem.org/Team:Tongji_China">Home</a> |
− | <a class="mdl-navigation__link mdl-typography--text-uppercase" href=" | + | <a class="mdl-navigation__link mdl-typography--text-uppercase" href="https://2017.igem.org/Team:Tongji_China/Description">Project</a> |
− | <a class="mdl-navigation__link mdl-typography--text-uppercase" href=" | + | <a class="mdl-navigation__link mdl-typography--text-uppercase" href="https://2017.igem.org/Team:Tongji_China/Team">Team</a> |
− | <a class="mdl-navigation__link mdl-typography--text-uppercase" href=" | + | <a class="mdl-navigation__link mdl-typography--text-uppercase" href="https://2017.igem.org/Team:Tongji_China/Results">Results</a> |
<!-- <a class="mdl-navigation__link mdl-typography--text-uppercase" href="">Auto</a> | <!-- <a class="mdl-navigation__link mdl-typography--text-uppercase" href="">Auto</a> | ||
<a class="mdl-navigation__link mdl-typography--text-uppercase" href="">One</a> | <a class="mdl-navigation__link mdl-typography--text-uppercase" href="">One</a> | ||
Line 151: | Line 170: | ||
</nav> | </nav> | ||
</div> | </div> | ||
+ | |||
+ | <!-- HERE STARTS THE PAGE --> | ||
<div class="android-content mdl-layout__content"> | <div class="android-content mdl-layout__content"> | ||
<a name="top"></a> | <a name="top"></a> | ||
− | <div class=" | + | <div class="mdl-typography--text-center" style="margin-bottom:20%"> |
− | <div class="logo-font android-slogan" style="color:# | + | <div class="logo-font android-slogan" style="color:#757575;">InterLab</div> |
− | <div class="logo-font android-sub-slogan" style="color:# | + | <div class="logo-font android-sub-slogan" style="color:#757575;">We partecipated in the 4<sup>th</sup> iGEM Interlab study along with about 100 teams. We have focused on quantifying the expression of GFP in common, comparable or absolute units.</div> |
− | + | ||
− | + | ||
− | + | ||
− | <a href="# | + | <!-- <a href="#InterLab"> |
<button class="android-fab mdl-button mdl-button--colored mdl-js-button mdl-button--fab mdl-js-ripple-effect"> | <button class="android-fab mdl-button mdl-button--colored mdl-js-button mdl-button--fab mdl-js-ripple-effect"> | ||
<i class="material-icons">expand_more</i> | <i class="material-icons">expand_more</i> | ||
</button> | </button> | ||
− | </a> | + | </a> --> |
</div> | </div> | ||
− | <div class=" | + | <!-- Background and Design --> |
− | < | + | <div class="demo-card-wide mdl-card mdl-shadow--2dp"> |
− | <div class="mdl- | + | <div class="mdl-card__title"> |
− | <div class="android- | + | <h4 class="mdl-card__title-text" style="font-size: 250%">Background & Design</h4> |
− | <div class="android- | + | </div> |
− | < | + | <div class="mdl-card__supporting-text" style="font-size: 115%"> |
− | < | + | Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in different units. In our case, we measured fluorescence using a plate reader. |
− | < | + | </div> |
− | </ | + | <div class="mdl-card__supporting-text" style="font-size: 115%"> |
− | < | + | It is very common to use fluorescence as a proxy for promoter activity, and the green fluorescent protein (GFP) is the most popular protein. Although detecting the intensity of fluorescence is an indirect measurement, we can use it as representative of the expression levels of GFP. This method has a significant advantage, which is that it allows to monitor continuously without disrupting cells. |
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
+ | Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell. | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
+ | We aim to proceed in the experiment using the supplied FITC as a standard reference material. The standard curve can be constructed by measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform a relative measurements of fluorescence into an absolute measurements of GFP. | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
+ | However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites. | ||
+ | </div> | ||
+ | <div class="android-drawer-separator"></div> | ||
+ | </div> | ||
+ | <!-- Description --> | ||
+ | <div class="demo-card-wide mdl-card mdl-shadow--2dp"> | ||
+ | <div class="mdl-card__title"> | ||
+ | <h4 class="mdl-card__title-text" style="font-size: 250%">Description</h4> | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
+ | Plasmids containing promoters and GFP were taken from The 2017 DNA Distribution Kit 7 and all devices were transformed into E. coli. | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
+ | 3ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol. | ||
+ | </div> | ||
+ | <div class="android-drawer-separator"></div> | ||
+ | </div> | ||
+ | <!-- Result --> | ||
+ | <div class="demo-card-wide mdl-card mdl-shadow--2dp"> | ||
+ | <div class="mdl-card__title"> | ||
+ | <h4 class="mdl-card__title-text" style="font-size: 250%">Results</h4> | ||
+ | </div> | ||
+ | |||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
+ | Sequencing | ||
+ | <div class="android-drawer-separator"></div> | ||
+ | <table class="mdl-data-table mdl-js-data-table mdl-data-table mdl-shadow--2dp" style="margin:auto"> | ||
+ | <thead> | ||
+ | <tr> | ||
+ | <th class="mdl-data-table__cell--non-numeric"></th> | ||
+ | <th class="mdl-data-table__cell--non-numeric">Length</th> | ||
+ | <th class="mdl-data-table__cell--non-numeric">Sequence</th> | ||
+ | </tr> | ||
+ | </thead> | ||
+ | <tbody> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">BBa_R0040 Part-only sequence</td> | ||
+ | <td>54 bp</td> | ||
+ | <td>tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">BBa_J23101 Part-only sequence</td> | ||
+ | <td>35 bp</td> | ||
+ | <td>tttacagctagctcagtcctaggtattatgctagc</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">BBa_J23106 Part-only sequence</td> | ||
+ | <td>35 bp</td> | ||
+ | <td>ttacggctagctcagtcctaggtatagtgctagc</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">BBa_J23117 Part-only sequence</td> | ||
+ | <td>35 bp</td> | ||
+ | <td>ttgacagctagctcagtcctagggattgtgctagc</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">BBa_J364100 Part-only sequence</td> | ||
+ | <td>84 bp</td> | ||
+ | <td>gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttct</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">BBa_B0010 Part-only sequence</td> | ||
+ | <td>80 bp</td> | ||
+ | <td>ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">BBa_B0012 Part-only sequence</td> | ||
+ | <td>41 bp</td> | ||
+ | <td>tcacactggctcaccttcgggtgggcctttctgcgtttata</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">BBa_E0040 Part-only sequence</td> | ||
+ | <td>720 bp</td> | ||
+ | <td style="white-space: pre-line;"> | ||
+ | atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtg | ||
+ | atgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaa | ||
+ | acttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtc | ||
+ | actactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatg | ||
+ | actttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaaga | ||
+ | tgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaataga | ||
+ | atcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaat | ||
+ | acaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagt | ||
+ | taacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaa | ||
+ | caaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacac | ||
+ | aatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgt | ||
+ | aacagctgctgggattacacatggcatggatgaactatacaaataataa | ||
+ | </td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | </div> | ||
+ | |||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
+ | Table 1 - OD600 Reference Point | ||
+ | <div class="android-drawer-separator"></div> | ||
+ | <table class="mdl-data-table mdl-js-data-table mdl-data-table mdl-shadow--2dp" style="margin:auto"> | ||
+ | <thead> | ||
+ | <tr> | ||
+ | <th class="mdl-data-table__cell--non-numeric"></th> | ||
+ | <th class="mdl-data-table__cell--non-numeric">LUDOX-HS40</th> | ||
+ | <th class="mdl-data-table__cell--non-numeric">H2O</th> | ||
+ | </tr> | ||
+ | </thead> | ||
+ | <tbody> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">Replicate 1</td> | ||
+ | <td>0.00624</td> | ||
+ | <td>-0.00726</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">Replicate 2</td> | ||
+ | <td>0.00684</td> | ||
+ | <td>-0.00526</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">Replicate 3</td> | ||
+ | <td>0.00734</td> | ||
+ | <td>-0.00366</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">Replicate 4</td> | ||
+ | <td>0.01104</td> | ||
+ | <td>-0.00476</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">Arithmetic Mean</td> | ||
+ | <td>0.007865</td> | ||
+ | <td>-0.00524</td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">Corrected Abs600</td> | ||
+ | <td>0.0131</td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">Reference OD600</td> | ||
+ | <td>0.0425</td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td class="mdl-data-table__cell--non-numeric">OD600/Abs600</td> | ||
+ | <td>3.244275</td> | ||
+ | <td></td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | </div> | ||
+ | |||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%; text-align:center"> | ||
+ | Table 2 - FITC Standard Curve | ||
+ | <div class="android-drawer-separator"></div> | ||
+ | <table class="mdl-data-table mdl-js-data-table mdl-data-table mdl-shadow--2dp" style="margin:auto"> | ||
+ | <thead> | ||
+ | <tr> | ||
+ | <th class="mdl-data-table__cell--non-numeric">uM Fluorescein</th> | ||
+ | <th class="mdl-data-table__cell--non-numeric">Replicate 1</th> | ||
+ | <th class="mdl-data-table__cell--non-numeric">Replicate 2</th> | ||
+ | <th class="mdl-data-table__cell--non-numeric">Replicate 3</th> | ||
+ | <th class="mdl-data-table__cell--non-numeric">Replicate 4</th> | ||
+ | <th class="mdl-data-table__cell--non-numeric">Arith. Mean</th> | ||
+ | <th class="mdl-data-table__cell--non-numeric">Arith. Std.Dev.</th> | ||
+ | </tr> | ||
+ | </thead> | ||
+ | <tbody> | ||
+ | <tr> | ||
+ | <td width="68"> | ||
+ | <p>50</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>61138.13773</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>65271.06373</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>64591.86073</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>65095.54373</p> | ||
+ | </td> | ||
+ | <td width="61"> | ||
+ | <p>64024.15148</p> | ||
+ | </td> | ||
+ | <td width="69"> | ||
+ | <p>1945.425461</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td width="68"> | ||
+ | <p>25</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>46595.20773</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>47958.14973</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>47759.33273</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>46973.06773</p> | ||
+ | </td> | ||
+ | <td width="61"> | ||
+ | <p>47321.43948</p> | ||
+ | </td> | ||
+ | <td width="69"> | ||
+ | <p>644.4444304</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td width="68"> | ||
+ | <p>12.5</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>28000.11673</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>29885.96173</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>29220.19473</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>29151.63573</p> | ||
+ | </td> | ||
+ | <td width="61"> | ||
+ | <p>29064.47723</p> | ||
+ | </td> | ||
+ | <td width="69"> | ||
+ | <p>783.0590871</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td width="68"> | ||
+ | <p>6.25</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>15683.49573</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>16760.13373</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>16218.20373</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>16178.31273</p> | ||
+ | </td> | ||
+ | <td width="61"> | ||
+ | <p>16210.03648</p> | ||
+ | </td> | ||
+ | <td width="69"> | ||
+ | <p>440.0474392</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td width="68"> | ||
+ | <p>3.125</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>8520.498733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>8943.591733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>8732.387733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>8904.756733</p> | ||
+ | </td> | ||
+ | <td width="61"> | ||
+ | <p>8775.308733</p> | ||
+ | </td> | ||
+ | <td width="69"> | ||
+ | <p>193.0857332</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td width="68"> | ||
+ | <p>1.5625</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>3763.249733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>4130.652733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>3895.511733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>4038.104733</p> | ||
+ | </td> | ||
+ | <td width="61"> | ||
+ | <p>3956.879733</p> | ||
+ | </td> | ||
+ | <td width="69"> | ||
+ | <p>161.3000976</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td width="68"> | ||
+ | <p>0.78125</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>1812.487733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>2054.542733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>1959.396733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>2020.259733</p> | ||
+ | </td> | ||
+ | <td width="61"> | ||
+ | <p>1961.671733</p> | ||
+ | </td> | ||
+ | <td width="69"> | ||
+ | <p>106.9557819</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td width="68"> | ||
+ | <p>0.390625</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>985.464733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>1054.489733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>1024.705733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>1069.755733</p> | ||
+ | </td> | ||
+ | <td width="61"> | ||
+ | <p>1033.603983</p> | ||
+ | </td> | ||
+ | <td width="69"> | ||
+ | <p>37.14713908</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td width="68"> | ||
+ | <p>0.1953125</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>497.078733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>527.161733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>514.866733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>522.469733</p> | ||
+ | </td> | ||
+ | <td width="61"> | ||
+ | <p>515.394233</p> | ||
+ | </td> | ||
+ | <td width="69"> | ||
+ | <p>13.21958841</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td width="68"> | ||
+ | <p>0.09765625</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>244.808733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>261.900733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>248.052733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>257.166733</p> | ||
+ | </td> | ||
+ | <td width="61"> | ||
+ | <p>252.982233</p> | ||
+ | </td> | ||
+ | <td width="69"> | ||
+ | <p>7.919506613</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td width="68"> | ||
+ | <p>0.048828125</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>119.568733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>122.370733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>123.219733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>127.955733</p> | ||
+ | </td> | ||
+ | <td width="61"> | ||
+ | <p>123.278733</p> | ||
+ | </td> | ||
+ | <td width="69"> | ||
+ | <p>3.48646784</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | <tr> | ||
+ | <td width="68"> | ||
+ | <p>0</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>0.419733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>0.411733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>0.046733</p> | ||
+ | </td> | ||
+ | <td width="55"> | ||
+ | <p>0.241733</p> | ||
+ | </td> | ||
+ | <td width="61"> | ||
+ | <p>0.279983</p> | ||
+ | </td> | ||
+ | <td width="69"> | ||
+ | <p>0.175837757</p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | </tbody> | ||
+ | </table> | ||
+ | |||
+ | |||
+ | |||
+ | </div> | ||
+ | |||
+ | <div class="android-drawer-separator"></div> | ||
+ | </div> | ||
+ | <!-- Methods and Materials --> | ||
+ | <div class="demo-card-wide mdl-card mdl-shadow--2dp"> | ||
+ | <div class="mdl-card__title"> | ||
+ | <h4 class="mdl-card__title-text" style="font-size: 250%">Methods & Materials</h4> | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
+ | Strain used: E. coli DH5-alpha | ||
+ | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%"> | ||
+ | Plasmid DNA (100 pg/uL in 10uL of water) | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 75%; white-space: pre-line;"> | ||
+ | Positive Control (BBa_I20270): J23151.B0032.E0040.B0010.B0012 in pSB1C3 | ||
+ | Negative Control (BBa_R0040): R0040 in pSB1C3 | ||
+ | Test Device 1 (BBa_J364000): J23101.B0034.E0040.B0010.B0012 in pSB1C3 | ||
+ | Test Device 2 (BBa_J364001): J23106.B0034.E0040.B0010.B0012 in pSB1C3 | ||
+ | Test Device 3 (BBa_J364002): J23117.B0034.E0040.B0010.B0012 in pSB1C3 | ||
+ | Test Device 4 (BBa_J364003): J23101.J364100.E0040.B0010.B0012 in pSB1C3 | ||
+ | Test Device 5 (BBa_J364004): J23106.J364100.E0040.B0010.B0012 in pSB1C3 | ||
+ | Test Device 6 (BBa_J364005): J23117.J364100.E0040.B0010.B0012 in pSB1C3 | ||
</div> | </div> | ||
− | + | </div> | |
− | + | <div class="mdl-card__supporting-text" style="font-size: 115%"> | |
− | + | Materials | |
− | + | <div class="mdl-card__supporting-text" style="font-size: 75%; white-space: pre-line;"> | |
− | + | FITC Standard: one tube with dried down FITC for creating a FITC standard | |
− | + | LUDOX: one tube with 30% colloidal silica suspended in 1mL of water | |
− | <div class=" | + | 1xPBS (phosphate buffered saline) |
− | + | LB (Luria Bertani) media | |
− | + | Chloramphenicol (stock concentration 25 mg/mL dissolved in EtOH) | |
− | + | 50 ml Falcon tube (or equivalent) or 250 ml shake flask for cell growth | |
− | + | 1.5 ml eppendorf tubes for sample storage | |
− | + | Ice bucket with ice | |
− | + | Pipettes | |
− | + | Black 96 well plate | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
</div> | </div> | ||
</div> | </div> | ||
+ | <div class="mdl-card__supporting-text" style="font-size: 115%; white-space: pre-line;"> | ||
+ | Machines: SpectraMax M5, SPX-150B-Z biochemical incubator and THZ-312 Thermostatic oscillator | ||
+ | Software: Microsoft Excel and pro5 | ||
+ | Calibration: OD600 Reference point and FITC fluorescence standard curve | ||
+ | Cell measurement: Transformation and Measurements | ||
+ | </div> | ||
+ | <div class="android-drawer-separator"></div> | ||
</div> | </div> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
<div class="android-wear-section"> | <div class="android-wear-section"> | ||
<div class="android-wear-band"> | <div class="android-wear-band"> |
Revision as of 22:51, 17 October 2017
Background & Design
Description
Results
Length | Sequence | |
---|---|---|
BBa_R0040 Part-only sequence | 54 bp | tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac |
BBa_J23101 Part-only sequence | 35 bp | tttacagctagctcagtcctaggtattatgctagc |
BBa_J23106 Part-only sequence | 35 bp | ttacggctagctcagtcctaggtatagtgctagc |
BBa_J23117 Part-only sequence | 35 bp | ttgacagctagctcagtcctagggattgtgctagc |
BBa_J364100 Part-only sequence | 84 bp | gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttct |
BBa_B0010 Part-only sequence | 80 bp | ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc |
BBa_B0012 Part-only sequence | 41 bp | tcacactggctcaccttcgggtgggcctttctgcgtttata |
BBa_E0040 Part-only sequence | 720 bp | atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtg atgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaa acttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtc actactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatg actttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaaga tgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaataga atcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaat acaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagt taacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaa caaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacac aatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgt aacagctgctgggattacacatggcatggatgaactatacaaataataa |
LUDOX-HS40 | H2O | |
---|---|---|
Replicate 1 | 0.00624 | -0.00726 |
Replicate 2 | 0.00684 | -0.00526 |
Replicate 3 | 0.00734 | -0.00366 |
Replicate 4 | 0.01104 | -0.00476 |
Arithmetic Mean | 0.007865 | -0.00524 |
Corrected Abs600 | 0.0131 | |
Reference OD600 | 0.0425 | |
OD600/Abs600 | 3.244275 |
uM Fluorescein | Replicate 1 | Replicate 2 | Replicate 3 | Replicate 4 | Arith. Mean | Arith. Std.Dev. |
---|---|---|---|---|---|---|
50 |
61138.13773 |
65271.06373 |
64591.86073 |
65095.54373 |
64024.15148 |
1945.425461 |
25 |
46595.20773 |
47958.14973 |
47759.33273 |
46973.06773 |
47321.43948 |
644.4444304 |
12.5 |
28000.11673 |
29885.96173 |
29220.19473 |
29151.63573 |
29064.47723 |
783.0590871 |
6.25 |
15683.49573 |
16760.13373 |
16218.20373 |
16178.31273 |
16210.03648 |
440.0474392 |
3.125 |
8520.498733 |
8943.591733 |
8732.387733 |
8904.756733 |
8775.308733 |
193.0857332 |
1.5625 |
3763.249733 |
4130.652733 |
3895.511733 |
4038.104733 |
3956.879733 |
161.3000976 |
0.78125 |
1812.487733 |
2054.542733 |
1959.396733 |
2020.259733 |
1961.671733 |
106.9557819 |
0.390625 |
985.464733 |
1054.489733 |
1024.705733 |
1069.755733 |
1033.603983 |
37.14713908 |
0.1953125 |
497.078733 |
527.161733 |
514.866733 |
522.469733 |
515.394233 |
13.21958841 |
0.09765625 |
244.808733 |
261.900733 |
248.052733 |
257.166733 |
252.982233 |
7.919506613 |
0.048828125 |
119.568733 |
122.370733 |
123.219733 |
127.955733 |
123.278733 |
3.48646784 |
0 |
0.419733 |
0.411733 |
0.046733 |
0.241733 |
0.279983 |
0.175837757 |
Methods & Materials
Like our fantastic advisors, some other people and maybe even a couple of companies!
Find out about our team and our friends