Difference between revisions of "Team:Tongji China/InterLab"

Our team took part in this study which aimed to standardize the measurements of fluorescence in different labs. The main task was to quantify expression of GFP in different units. In our case, we measured fluorescence using a plate reader.

It is very common to use fluorescence as a proxy for promoter activity, and the green fluorescent protein (GFP) is the most popular protein. Although detecting the intensity of fluorescence is an indirect measurement, we can use it as representative of the expression levels of GFP. This method has a significant advantage, which is that it allows to monitor continuously without disrupting cells.
Fluorescence/OD600 is routinely used to give an adjustment of the relative expression per cell.

We aim to proceed in the experiment using the supplied FITC as a standard reference material. The standard curve can be constructed by measuring the fluorescence of a dilution series. We have previously performed this standard curve on our own instrument alongside a standard curve for purified GFP. Using these standard curves alongside your own standard curve for FITC it is thus possible to transform a relative measurements of fluorescence into an absolute measurements of GFP.

However, we aim to contain instrument variability, at least to some degree, by measuring a standard scattering solution of a mono-dispersed silica suspension (LUDOX). The objective is to see if a simple, single fixed-point measurement can be used as a ratiometric adjustment to provide greater uniformity in fluorescence/OD600 measurements across sites.

Plasmids containing promoters and GFP were taken from The 2017 DNA Distribution Kit 7 and all devices were transformed into E. coli.

3ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.

Sequencing

	Length	Sequence
BBa_R0040 Part-only sequence	54 bp	tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac
BBa_J23101 Part-only sequence	35 bp	tttacagctagctcagtcctaggtattatgctagc
BBa_J23106 Part-only sequence	35 bp	ttacggctagctcagtcctaggtatagtgctagc
BBa_J23117 Part-only sequence	35 bp	ttgacagctagctcagtcctagggattgtgctagc
BBa_J364100 Part-only sequence	84 bp	gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttct
BBa_B0010 Part-only sequence	80 bp	ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc
BBa_B0012 Part-only sequence	41 bp	tcacactggctcaccttcgggtgggcctttctgcgtttata
BBa_E0040 Part-only sequence	720 bp	atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtg atgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaa acttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtc actactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatg actttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaaga tgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaataga atcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaat acaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagt taacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaa caaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacac aatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgt aacagctgctgggattacacatggcatggatgaactatacaaataataa

Table 1 - OD600 Reference Point

	LUDOX-HS40	H2O
Replicate 1	0.00624	-0.00726
Replicate 2	0.00684	-0.00526
Replicate 3	0.00734	-0.00366
Replicate 4	0.01104	-0.00476
Arithmetic Mean	0.007865	-0.00524
Corrected Abs600	0.0131
Reference OD600	0.0425
OD600/Abs600	3.244275

Table 2 - FITC Standard Curve

uM Fluorescein	Replicate 1	Replicate 2	Replicate 3	Replicate 4	Arith. Mean	Arith. Std.Dev.
50	61138.13773	65271.06373	64591.86073	65095.54373	64024.15148	1945.425461
25	46595.20773	47958.14973	47759.33273	46973.06773	47321.43948	644.4444304
12.5	28000.11673	29885.96173	29220.19473	29151.63573	29064.47723	783.0590871
6.25	15683.49573	16760.13373	16218.20373	16178.31273	16210.03648	440.0474392
3.125	8520.498733	8943.591733	8732.387733	8904.756733	8775.308733	193.0857332
1.5625	3763.249733	4130.652733	3895.511733	4038.104733	3956.879733	161.3000976
0.78125	1812.487733	2054.542733	1959.396733	2020.259733	1961.671733	106.9557819
0.390625	985.464733	1054.489733	1024.705733	1069.755733	1033.603983	37.14713908
0.1953125	497.078733	527.161733	514.866733	522.469733	515.394233	13.21958841
0.09765625	244.808733	261.900733	248.052733	257.166733	252.982233	7.919506613
0.048828125	119.568733	122.370733	123.219733	127.955733	123.278733	3.48646784
0	0.419733	0.411733	0.046733	0.241733	0.279983	0.175837757

Figure 1 - Fluorescein standard curve

Figure 2 - Fluorescein standard curve [log scale]

Table 3 - Raw data of Abs600 measurement

		0	2	4	6
Negative Control	CLONE 1	0.0295	0.130507	0.314472	0.42238
	CLONE 2	0.031975	0.135382	0.354122	0.43548
Positive Control	CLONE 1	0.0305	0.161232	0.351597	0.488955
	CLONE 2	0.02885	0.162257	0.417697	0.50018
Test Device 1	CLONE 1	0.028375	0.057732	0.148547	0.269505
	CLONE 2	0.02985	0.048457	0.112622	0.20678
Test Device 2	CLONE 1	0.0314	0.148682	0.394347	0.46823
	CLONE 2	0.029025	0.125007	0.375497	0.43273
Test Device 3	CLONE 1	0.030775	0.167307	0.400422	0.456205
	CLONE 2	0.027175	0.156457	0.405647	0.483105
Test Device 4	CLONE 1	0.0305	0.158857	0.398722	0.45088
	CLONE 2	0.03015	0.155507	0.401822	0.453755
Test Device 5	CLONE 1	0.0362	0.163682	0.410647	0.472155
	CLONE 2	0.03205	0.142507	0.377622	0.436505
Test Device 6	CLONE 1	0.03545	0.176682	0.385822	0.45088
	CLONE 2	0.02795	0.153382	0.402072	0.449205

Figure 3 - Correction of Abs600 measurement

Table 4 - Raw data of fluorescence measurement

		0	2	4	6
Negative Control	CLONE 1	1.08025	2.16875	16.13602	29.83945
	CLONE 2	1.96175	1.974	19.02202	32.08245
Positive Control	CLONE 1	13.218	157.839	413.9833	493.0602
	CLONE 2	19.26725	178.7663	485.3383	578.5027
Test Device 1	CLONE 1	203.4893	515.1385	1366.608	2527.968
	CLONE 2	216.369	550.578	1161.084	2002.293
Test Device 2	CLONE 1	52.94075	330.942	1212.613	1625.767
	CLONE 2	57.626	300.5665	1104.674	1431.868
Test Device 3	CLONE 1	2.81475	4.924	32.52677	47.32195
	CLONE 2	3.3015	4.3785	31.76152	56.2147
Test Device 4	CLONE 1	2.65525	6.173	34.00727	45.5552
	CLONE 2	2.00575	5.008	37.20552	51.47795
Test Device 5	CLONE 1	19.70225	167.6278	435.9625	529.8542
	CLONE 2	17.1425	140.0155	430.8645	498.9205
Test Device 6	CLONE 1	3.124	5.37275	19.22877	30.8587
	CLONE 2	1.186134	5.4735	27.23052	39.53995

Figure 4 - Correction of fluorescence measurement

Table 5 - Raw data of Fl/Abs600

		0H	2H	4H	6H
Negative Control	Colony 1	0.0049	0.0021	0.0066	0.0091
	Colony 2	0.0080	0.0019	0.0070	0.0095
Positive Control	Colony 1	0.0559	0.1265	0.1525	0.1303
	Colony 2	0.0866	0.1422	0.1501	0.1493
Test Device 1	Colony 1	0.9270	1.1547	1.1894	1.2126
	Colony 2	0.9366	1.4767	1.3349	1.2506
Test Device 2	Colony 1	0.2177	0.2875	0.3997	0.4487
	Colony 2	0.2583	0.3105	0.3807	0.4273
Test Device 3	Colony 1	0.0118	0.0038	0.0104	0.0133
	Colony 2	0.0166	0.0036	0.0102	0.0150
Test Device 4	Colony 1	0.0114	0.0050	0.0109	0.0130
	Colony 2	0.0089	0.0042	0.0120	0.0146
Test Device 5	Colony 1	0.0710	0.1324	0.1375	0.1449
	Colony 2	0.0685	0.1269	0.1476	0.1476
Test Device 6	Colony 1	0.0113	0.0039	0.0064	0.0088
	Colony 2	0.0055	0.0046	0.0087	0.0114

Figure 5 - Average level of devices

Conclusions

It is noticeable that the promoter of the Device 1 is the strongest followed by the promoters of the devices 2 and 5. But the device 3, 4 and 6 are not active.

Strain used: E. coli DH5-alpha

Plasmid DNA (100 pg/uL in 10uL of water)
Materials

Machines: SpectraMax M5, SPX-150B-Z biochemical incubator and THZ-312 Thermostatic oscillator Software: Microsoft Excel and pro5 Calibration: OD600 Reference point and FITC fluorescence standard curve Cell measurement: Transformation and Measurements Protocol for calibration and measurement Raw Data